Incidental Mutation 'R4543:Tmprss11a'
ID333618
Institutional Source Beutler Lab
Gene Symbol Tmprss11a
Ensembl Gene ENSMUSG00000072845
Gene Nametransmembrane protease, serine 11a
SynonymsLOC194597
MMRRC Submission 041778-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4543 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location86410410-86468990 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 86411809 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 375 (Q375*)
Ref Sequence ENSEMBL: ENSMUSP00000098634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101073]
Predicted Effect probably null
Transcript: ENSMUST00000101073
AA Change: Q375*
SMART Domains Protein: ENSMUSP00000098634
Gene: ENSMUSG00000072845
AA Change: Q375*

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
Pfam:SEA 36 135 3.2e-23 PFAM
Tryp_SPc 157 383 1.98e-87 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198504
Meta Mutation Damage Score 0.9717 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 94% (44/47)
MGI Phenotype PHENOTYPE: Homozygous mice for a targeted mutation appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik T A 1: 134,389,793 M101K probably benign Het
A1bg A T 15: 60,917,900 S500T probably damaging Het
Abhd3 T C 18: 10,706,672 D2G possibly damaging Het
Ablim1 C T 19: 57,077,442 R366H possibly damaging Het
Adgre1 T A 17: 57,406,874 H186Q probably benign Het
Ankmy1 G T 1: 92,884,850 A579E probably damaging Het
Ap2b1 C A 11: 83,324,650 T140K probably damaging Het
Arhgef28 T A 13: 98,075,000 E158D probably benign Het
Atp8b4 A G 2: 126,358,066 F885L probably damaging Het
Barx2 A G 9: 31,846,796 L282S unknown Het
Catsper2 C T 2: 121,407,409 W163* probably null Het
Cep295 T C 9: 15,335,253 T588A possibly damaging Het
Chil3 T G 3: 106,160,370 K160Q probably benign Het
Clca3a1 T A 3: 144,746,988 Q578L probably damaging Het
Crp A C 1: 172,698,737 I130L probably benign Het
Dtwd2 C A 18: 49,724,108 probably null Het
Fads3 T C 19: 10,041,811 F27S possibly damaging Het
Gm3604 T C 13: 62,370,156 D109G probably benign Het
Gtf2ird1 A G 5: 134,363,900 probably null Het
H2-K1 C T 17: 33,999,558 probably null Het
Hdac5 T C 11: 102,213,944 probably benign Het
Il6st G A 13: 112,481,459 V136M probably damaging Het
Immt T C 6: 71,851,778 S106P probably damaging Het
Kat2b T C 17: 53,653,140 I492T probably benign Het
Kcnn2 T C 18: 45,559,648 F97S probably benign Het
Kdm4c A G 4: 74,330,760 I84V probably benign Het
Kif7 G A 7: 79,707,548 P637S probably benign Het
Lrrcc1 T A 3: 14,539,791 I109K probably damaging Het
Med12l T A 3: 59,091,508 C619S probably damaging Het
Olfr919 A G 9: 38,697,545 S274P possibly damaging Het
Polq T C 16: 37,060,785 C1104R probably benign Het
Rbfox2 A T 15: 77,306,368 M59K probably benign Het
Rft1 T C 14: 30,661,333 V110A probably benign Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,922 probably benign Het
Slc2a12 T A 10: 22,664,786 V180D probably damaging Het
Sox21 CCAGCGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCGGC CCAGCGGCGGCGGCGGCAGCGGC 14: 118,235,136 probably benign Het
Stap2 C T 17: 55,997,604 probably null Het
Tenm4 A G 7: 96,895,815 N2375S probably benign Het
Tmem132c A G 5: 127,504,977 T419A probably benign Het
Trav12-3 CTCTG CTCTGTCTG 14: 53,622,236 probably null Het
Vmn1r88 T A 7: 13,177,980 S88T possibly damaging Het
Zfp622 T A 15: 25,991,537 D143E possibly damaging Het
Other mutations in Tmprss11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01596:Tmprss11a APN 5 86422519 missense probably damaging 1.00
IGL02413:Tmprss11a APN 5 86422648 missense possibly damaging 0.50
IGL02533:Tmprss11a APN 5 86414527 missense probably damaging 0.96
R1202:Tmprss11a UTSW 5 86411925 critical splice acceptor site probably null
R1273:Tmprss11a UTSW 5 86414588 missense probably benign 0.10
R1704:Tmprss11a UTSW 5 86428702 missense probably benign 0.25
R1756:Tmprss11a UTSW 5 86420179 missense probably damaging 1.00
R1783:Tmprss11a UTSW 5 86420032 missense probably damaging 0.98
R1967:Tmprss11a UTSW 5 86431843 missense probably benign 0.23
R2944:Tmprss11a UTSW 5 86428652 missense probably benign 0.19
R3881:Tmprss11a UTSW 5 86445805 missense possibly damaging 0.85
R4512:Tmprss11a UTSW 5 86428578 missense probably benign 0.00
R4515:Tmprss11a UTSW 5 86420196 missense probably damaging 1.00
R4530:Tmprss11a UTSW 5 86428681 missense possibly damaging 0.79
R4881:Tmprss11a UTSW 5 86422573 missense probably damaging 1.00
R5066:Tmprss11a UTSW 5 86420000 critical splice donor site probably null
R5186:Tmprss11a UTSW 5 86420079 missense probably damaging 1.00
R5254:Tmprss11a UTSW 5 86411806 missense probably damaging 0.99
R5313:Tmprss11a UTSW 5 86411815 missense probably damaging 1.00
R6516:Tmprss11a UTSW 5 86420128 missense probably damaging 1.00
R6920:Tmprss11a UTSW 5 86428635 missense probably benign 0.23
R7018:Tmprss11a UTSW 5 86428570 missense probably damaging 0.96
R7566:Tmprss11a UTSW 5 86444134 missense possibly damaging 0.50
R7962:Tmprss11a UTSW 5 86420020 missense probably damaging 1.00
X0057:Tmprss11a UTSW 5 86445808 missense probably benign 0.03
X0063:Tmprss11a UTSW 5 86414578 missense probably damaging 1.00
Z1176:Tmprss11a UTSW 5 86428631 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTTCACATTGCTAGGTCCAGC -3'
(R):5'- ACGTGGTTCTTAAGGTGATATTCAG -3'

Sequencing Primer
(F):5'- ACATTGCTAGGTCCAGCCATTTAATC -3'
(R):5'- CATCTCATGTCCAGCAGTAGATG -3'
Posted On2015-08-18