Incidental Mutation 'R4543:Tenm4'
ID 333625
Institutional Source Beutler Lab
Gene Symbol Tenm4
Ensembl Gene ENSMUSG00000048078
Gene Name teneurin transmembrane protein 4
Synonyms l7Rn3, Doc4, Ten-m4, ELM2, l(7)-3Rn, Odz4
MMRRC Submission 041778-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4543 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 95820453-96560300 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 96545022 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 2375 (N2375S)
Ref Sequence ENSEMBL: ENSMUSP00000102780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107162] [ENSMUST00000107165] [ENSMUST00000107166]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000107162
AA Change: N2375S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000102780
Gene: ENSMUSG00000048078
AA Change: N2375S

DomainStartEndE-ValueType
Pfam:Ten_N 10 410 5.6e-195 PFAM
transmembrane domain 411 433 N/A INTRINSIC
EGF_like 637 665 3.43e1 SMART
EGF 668 696 2.29e1 SMART
EGF 701 730 1.88e-1 SMART
EGF 733 762 1.13e1 SMART
EGF 767 797 2.39e1 SMART
EGF 800 828 4.32e-1 SMART
EGF 831 859 6.02e0 SMART
EGF 862 894 9.93e-1 SMART
low complexity region 900 914 N/A INTRINSIC
Pfam:RHS_repeat 2327 2380 5.5e-7 PFAM
Pfam:Tox-GHH 2740 2818 5.2e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107165
AA Change: N2383S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102783
Gene: ENSMUSG00000048078
AA Change: N2383S

DomainStartEndE-ValueType
Pfam:Ten_N 36 402 1.1e-171 PFAM
transmembrane domain 403 425 N/A INTRINSIC
EGF_like 629 657 3.43e1 SMART
EGF 660 688 2.29e1 SMART
EGF 693 722 1.88e-1 SMART
EGF 725 754 1.13e1 SMART
EGF 759 789 2.39e1 SMART
EGF 792 820 4.32e-1 SMART
EGF 823 851 6.02e0 SMART
EGF 863 895 9.93e-1 SMART
low complexity region 901 915 N/A INTRINSIC
Pfam:RHS_repeat 2335 2368 1.6e-7 PFAM
Pfam:Tox-GHH 2749 2826 1.8e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107166
AA Change: N2346S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102784
Gene: ENSMUSG00000048078
AA Change: N2346S

DomainStartEndE-ValueType
Pfam:Ten_N 35 193 1.4e-83 PFAM
Pfam:Ten_N 187 365 5e-78 PFAM
transmembrane domain 366 388 N/A INTRINSIC
EGF_like 592 620 3.43e1 SMART
EGF 623 651 2.29e1 SMART
EGF 656 685 1.88e-1 SMART
EGF 688 717 1.13e1 SMART
EGF 722 752 2.39e1 SMART
EGF 755 783 4.32e-1 SMART
EGF 786 814 6.02e0 SMART
EGF 826 858 9.93e-1 SMART
low complexity region 864 878 N/A INTRINSIC
Pfam:RHS_repeat 2298 2351 3.8e-7 PFAM
Pfam:Tox-GHH 2711 2789 3.9e-34 PFAM
Meta Mutation Damage Score 0.0600 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 94% (44/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays a role in establishing proper neuronal connectivity during development. Defects in this gene have been associated with hereditary essential tremor-5. [provided by RefSeq, Oct 2016]
PHENOTYPE: Various ENU-induced alleles cause prenatal lethality associated with impaired mesoderm development and lead to pleiotropic phenotypes. The most severe alleles cause failure of gastrulation and somitogenesis while the least severe one allows survival to adulthood with runting of variable penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg A T 15: 60,789,749 (GRCm39) S500T probably damaging Het
Abhd3 T C 18: 10,706,672 (GRCm39) D2G possibly damaging Het
Ablim1 C T 19: 57,065,874 (GRCm39) R366H possibly damaging Het
Adgre1 T A 17: 57,713,874 (GRCm39) H186Q probably benign Het
Ankmy1 G T 1: 92,812,572 (GRCm39) A579E probably damaging Het
Ap2b1 C A 11: 83,215,476 (GRCm39) T140K probably damaging Het
Arhgef28 T A 13: 98,211,508 (GRCm39) E158D probably benign Het
Atp8b4 A G 2: 126,199,986 (GRCm39) F885L probably damaging Het
Barx2 A G 9: 31,758,092 (GRCm39) L282S unknown Het
Catsper2 C T 2: 121,237,890 (GRCm39) W163* probably null Het
Cep295 T C 9: 15,246,549 (GRCm39) T588A possibly damaging Het
Chil3 T G 3: 106,067,686 (GRCm39) K160Q probably benign Het
Clca3a1 T A 3: 144,452,749 (GRCm39) Q578L probably damaging Het
Crp A C 1: 172,526,304 (GRCm39) I130L probably benign Het
Dtwd2 C A 18: 49,857,175 (GRCm39) probably null Het
Fads3 T C 19: 10,019,175 (GRCm39) F27S possibly damaging Het
Gm3604 T C 13: 62,517,970 (GRCm39) D109G probably benign Het
Gtf2ird1 A G 5: 134,392,754 (GRCm39) probably null Het
H2-K2 C T 17: 34,218,532 (GRCm39) probably null Het
Hdac5 T C 11: 102,104,770 (GRCm39) probably benign Het
Il6st G A 13: 112,617,993 (GRCm39) V136M probably damaging Het
Immt T C 6: 71,828,762 (GRCm39) S106P probably damaging Het
Kat2b T C 17: 53,960,168 (GRCm39) I492T probably benign Het
Kcnn2 T C 18: 45,692,715 (GRCm39) F97S probably benign Het
Kdm4c A G 4: 74,248,997 (GRCm39) I84V probably benign Het
Kif7 G A 7: 79,357,296 (GRCm39) P637S probably benign Het
Lrrcc1 T A 3: 14,604,851 (GRCm39) I109K probably damaging Het
Med12l T A 3: 58,998,929 (GRCm39) C619S probably damaging Het
Mgat4f T A 1: 134,317,531 (GRCm39) M101K probably benign Het
Or8g51 A G 9: 38,608,841 (GRCm39) S274P possibly damaging Het
Polq T C 16: 36,881,147 (GRCm39) C1104R probably benign Het
Rbfox2 A T 15: 77,190,568 (GRCm39) M59K probably benign Het
Rft1 T C 14: 30,383,290 (GRCm39) V110A probably benign Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,229,129 (GRCm39) probably benign Het
Slc2a12 T A 10: 22,540,685 (GRCm39) V180D probably damaging Het
Sox21 CCAGCGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCGGC CCAGCGGCGGCGGCGGCAGCGGC 14: 118,472,548 (GRCm39) probably benign Het
Stap2 C T 17: 56,304,604 (GRCm39) probably null Het
Tmem132c A G 5: 127,582,041 (GRCm39) T419A probably benign Het
Tmprss11a G A 5: 86,559,668 (GRCm39) Q375* probably null Het
Trav12-3 CTCTG CTCTGTCTG 14: 53,859,693 (GRCm39) probably null Het
Vmn1r88 T A 7: 12,911,907 (GRCm39) S88T possibly damaging Het
Zfp622 T A 15: 25,991,623 (GRCm39) D143E possibly damaging Het
Other mutations in Tenm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Tenm4 APN 7 96,517,216 (GRCm39) missense probably benign 0.00
IGL00468:Tenm4 APN 7 96,523,679 (GRCm39) missense probably damaging 0.98
IGL00519:Tenm4 APN 7 96,454,345 (GRCm39) splice site probably benign
IGL00979:Tenm4 APN 7 96,378,598 (GRCm39) missense probably damaging 0.96
IGL01401:Tenm4 APN 7 96,523,474 (GRCm39) missense probably damaging 1.00
IGL01459:Tenm4 APN 7 96,378,592 (GRCm39) missense probably damaging 1.00
IGL01519:Tenm4 APN 7 96,544,384 (GRCm39) missense probably damaging 1.00
IGL01545:Tenm4 APN 7 96,523,510 (GRCm39) missense probably benign 0.00
IGL01579:Tenm4 APN 7 96,512,709 (GRCm39) missense probably benign 0.00
IGL01587:Tenm4 APN 7 96,512,709 (GRCm39) missense probably benign 0.00
IGL01625:Tenm4 APN 7 96,534,565 (GRCm39) missense probably damaging 1.00
IGL01655:Tenm4 APN 7 96,202,931 (GRCm39) missense probably damaging 1.00
IGL01683:Tenm4 APN 7 96,534,611 (GRCm39) missense possibly damaging 0.84
IGL01728:Tenm4 APN 7 96,545,271 (GRCm39) missense probably damaging 1.00
IGL01732:Tenm4 APN 7 96,544,716 (GRCm39) missense probably damaging 1.00
IGL01924:Tenm4 APN 7 96,544,419 (GRCm39) missense probably damaging 1.00
IGL01966:Tenm4 APN 7 96,202,757 (GRCm39) missense probably damaging 1.00
IGL02177:Tenm4 APN 7 96,544,869 (GRCm39) missense probably benign 0.40
IGL02207:Tenm4 APN 7 96,523,323 (GRCm39) missense possibly damaging 0.85
IGL02269:Tenm4 APN 7 96,473,029 (GRCm39) missense probably damaging 1.00
IGL02274:Tenm4 APN 7 96,503,941 (GRCm39) missense probably damaging 1.00
IGL02375:Tenm4 APN 7 96,353,344 (GRCm39) missense possibly damaging 0.52
IGL02415:Tenm4 APN 7 96,523,281 (GRCm39) missense probably damaging 0.98
IGL02472:Tenm4 APN 7 96,423,383 (GRCm39) unclassified probably benign
IGL02656:Tenm4 APN 7 96,534,640 (GRCm39) missense probably damaging 1.00
IGL02678:Tenm4 APN 7 96,545,426 (GRCm39) missense probably damaging 1.00
IGL02829:Tenm4 APN 7 96,544,205 (GRCm39) nonsense probably null
IGL02863:Tenm4 APN 7 96,522,913 (GRCm39) missense probably damaging 1.00
IGL03145:Tenm4 APN 7 96,492,175 (GRCm39) missense probably damaging 0.98
IGL03153:Tenm4 APN 7 96,522,969 (GRCm39) missense probably damaging 1.00
principium UTSW 7 96,446,688 (GRCm39) missense probably damaging 0.98
toccata UTSW 7 96,552,196 (GRCm39) critical splice donor site probably null
P0026:Tenm4 UTSW 7 96,523,734 (GRCm39) missense probably damaging 1.00
R0097:Tenm4 UTSW 7 96,542,133 (GRCm39) missense probably damaging 1.00
R0097:Tenm4 UTSW 7 96,542,133 (GRCm39) missense probably damaging 1.00
R0140:Tenm4 UTSW 7 96,545,259 (GRCm39) missense possibly damaging 0.78
R0164:Tenm4 UTSW 7 96,378,547 (GRCm39) splice site probably benign
R0277:Tenm4 UTSW 7 96,344,157 (GRCm39) missense possibly damaging 0.54
R0323:Tenm4 UTSW 7 96,344,157 (GRCm39) missense possibly damaging 0.54
R0362:Tenm4 UTSW 7 96,421,242 (GRCm39) nonsense probably null
R0381:Tenm4 UTSW 7 96,555,088 (GRCm39) missense probably damaging 1.00
R0420:Tenm4 UTSW 7 96,522,973 (GRCm39) missense possibly damaging 0.85
R0426:Tenm4 UTSW 7 96,427,058 (GRCm39) missense probably damaging 1.00
R0513:Tenm4 UTSW 7 96,544,830 (GRCm39) missense probably benign 0.35
R0624:Tenm4 UTSW 7 96,423,227 (GRCm39) missense probably damaging 1.00
R0837:Tenm4 UTSW 7 96,545,482 (GRCm39) splice site probably benign
R1037:Tenm4 UTSW 7 96,446,688 (GRCm39) missense probably damaging 0.98
R1172:Tenm4 UTSW 7 96,497,251 (GRCm39) missense probably damaging 1.00
R1422:Tenm4 UTSW 7 96,199,258 (GRCm39) missense probably damaging 0.99
R1427:Tenm4 UTSW 7 96,492,255 (GRCm39) missense probably benign 0.42
R1462:Tenm4 UTSW 7 96,353,360 (GRCm39) missense probably damaging 1.00
R1462:Tenm4 UTSW 7 96,353,360 (GRCm39) missense probably damaging 1.00
R1597:Tenm4 UTSW 7 96,552,196 (GRCm39) critical splice donor site probably null
R1701:Tenm4 UTSW 7 96,552,096 (GRCm39) missense probably damaging 1.00
R1707:Tenm4 UTSW 7 96,537,892 (GRCm39) missense probably damaging 1.00
R1809:Tenm4 UTSW 7 96,522,987 (GRCm39) missense probably benign 0.17
R1812:Tenm4 UTSW 7 96,545,147 (GRCm39) missense probably damaging 1.00
R1895:Tenm4 UTSW 7 96,385,015 (GRCm39) missense probably damaging 1.00
R1933:Tenm4 UTSW 7 96,544,533 (GRCm39) missense probably damaging 1.00
R1946:Tenm4 UTSW 7 96,385,015 (GRCm39) missense probably damaging 1.00
R2108:Tenm4 UTSW 7 96,555,497 (GRCm39) missense probably damaging 1.00
R2151:Tenm4 UTSW 7 96,552,054 (GRCm39) missense probably damaging 1.00
R2247:Tenm4 UTSW 7 96,555,216 (GRCm39) missense probably benign 0.03
R2329:Tenm4 UTSW 7 96,545,069 (GRCm39) missense probably benign 0.00
R2893:Tenm4 UTSW 7 96,544,197 (GRCm39) missense probably damaging 1.00
R2990:Tenm4 UTSW 7 96,542,332 (GRCm39) splice site probably null
R3409:Tenm4 UTSW 7 96,544,367 (GRCm39) missense probably damaging 1.00
R3410:Tenm4 UTSW 7 96,501,737 (GRCm39) missense probably damaging 0.99
R3411:Tenm4 UTSW 7 96,501,737 (GRCm39) missense probably damaging 0.99
R3440:Tenm4 UTSW 7 96,202,723 (GRCm39) missense probably benign 0.00
R3441:Tenm4 UTSW 7 96,202,723 (GRCm39) missense probably benign 0.00
R3719:Tenm4 UTSW 7 96,512,770 (GRCm39) missense possibly damaging 0.92
R3772:Tenm4 UTSW 7 96,344,087 (GRCm39) missense probably damaging 1.00
R3773:Tenm4 UTSW 7 96,344,087 (GRCm39) missense probably damaging 1.00
R4093:Tenm4 UTSW 7 96,544,979 (GRCm39) missense probably damaging 1.00
R4439:Tenm4 UTSW 7 96,545,022 (GRCm39) missense probably benign 0.01
R4441:Tenm4 UTSW 7 96,545,022 (GRCm39) missense probably benign 0.01
R4510:Tenm4 UTSW 7 96,544,070 (GRCm39) missense probably benign
R4511:Tenm4 UTSW 7 96,544,070 (GRCm39) missense probably benign
R4645:Tenm4 UTSW 7 96,544,949 (GRCm39) missense probably damaging 1.00
R4701:Tenm4 UTSW 7 96,544,556 (GRCm39) missense probably damaging 1.00
R4707:Tenm4 UTSW 7 96,423,253 (GRCm39) missense probably damaging 0.99
R4714:Tenm4 UTSW 7 96,544,131 (GRCm39) missense probably damaging 1.00
R4742:Tenm4 UTSW 7 96,446,691 (GRCm39) missense probably damaging 0.99
R4784:Tenm4 UTSW 7 96,423,253 (GRCm39) missense probably damaging 0.99
R4785:Tenm4 UTSW 7 96,423,253 (GRCm39) missense probably damaging 0.99
R4801:Tenm4 UTSW 7 96,555,452 (GRCm39) missense probably damaging 0.97
R4802:Tenm4 UTSW 7 96,555,452 (GRCm39) missense probably damaging 0.97
R4880:Tenm4 UTSW 7 96,555,025 (GRCm39) splice site probably null
R5036:Tenm4 UTSW 7 96,501,768 (GRCm39) missense probably damaging 1.00
R5036:Tenm4 UTSW 7 96,343,997 (GRCm39) missense probably damaging 1.00
R5050:Tenm4 UTSW 7 96,544,995 (GRCm39) missense probably damaging 1.00
R5103:Tenm4 UTSW 7 96,492,164 (GRCm39) missense probably damaging 1.00
R5106:Tenm4 UTSW 7 96,492,356 (GRCm39) missense probably damaging 0.99
R5118:Tenm4 UTSW 7 96,542,293 (GRCm39) missense probably damaging 1.00
R5272:Tenm4 UTSW 7 96,523,410 (GRCm39) missense probably damaging 0.98
R5282:Tenm4 UTSW 7 96,486,538 (GRCm39) missense possibly damaging 0.90
R5403:Tenm4 UTSW 7 96,538,034 (GRCm39) missense probably damaging 1.00
R5404:Tenm4 UTSW 7 96,543,887 (GRCm39) missense probably damaging 1.00
R5567:Tenm4 UTSW 7 96,545,416 (GRCm39) nonsense probably null
R5590:Tenm4 UTSW 7 96,446,608 (GRCm39) missense possibly damaging 0.93
R5590:Tenm4 UTSW 7 96,446,607 (GRCm39) missense possibly damaging 0.73
R5597:Tenm4 UTSW 7 96,202,724 (GRCm39) missense probably benign 0.00
R5782:Tenm4 UTSW 7 96,542,246 (GRCm39) missense probably benign 0.00
R5861:Tenm4 UTSW 7 96,492,424 (GRCm39) intron probably benign
R5890:Tenm4 UTSW 7 96,552,067 (GRCm39) missense probably damaging 1.00
R5930:Tenm4 UTSW 7 96,503,926 (GRCm39) missense probably damaging 1.00
R5940:Tenm4 UTSW 7 96,495,102 (GRCm39) missense probably damaging 1.00
R6012:Tenm4 UTSW 7 96,171,640 (GRCm39) intron probably benign
R6060:Tenm4 UTSW 7 96,522,918 (GRCm39) missense probably damaging 1.00
R6104:Tenm4 UTSW 7 96,486,496 (GRCm39) missense probably damaging 0.97
R6283:Tenm4 UTSW 7 96,523,701 (GRCm39) missense probably benign 0.33
R6333:Tenm4 UTSW 7 96,423,331 (GRCm39) missense probably damaging 1.00
R6522:Tenm4 UTSW 7 96,492,251 (GRCm39) missense possibly damaging 0.88
R6616:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R6746:Tenm4 UTSW 7 96,542,067 (GRCm39) missense probably damaging 1.00
R6751:Tenm4 UTSW 7 96,494,919 (GRCm39) missense possibly damaging 0.95
R6806:Tenm4 UTSW 7 96,461,166 (GRCm39) missense possibly damaging 0.95
R6807:Tenm4 UTSW 7 96,544,478 (GRCm39) missense probably damaging 1.00
R6807:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R6809:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R6810:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R6811:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R6853:Tenm4 UTSW 7 96,486,502 (GRCm39) missense possibly damaging 0.94
R6886:Tenm4 UTSW 7 96,446,599 (GRCm39) missense possibly damaging 0.85
R6920:Tenm4 UTSW 7 96,544,757 (GRCm39) missense probably damaging 1.00
R6937:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R6939:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R7011:Tenm4 UTSW 7 96,545,342 (GRCm39) nonsense probably null
R7033:Tenm4 UTSW 7 96,544,430 (GRCm39) nonsense probably null
R7040:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R7083:Tenm4 UTSW 7 96,544,556 (GRCm39) missense probably damaging 1.00
R7238:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R7239:Tenm4 UTSW 7 96,385,020 (GRCm39) missense possibly damaging 0.47
R7239:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R7337:Tenm4 UTSW 7 96,523,333 (GRCm39) missense probably benign 0.44
R7400:Tenm4 UTSW 7 96,344,010 (GRCm39) missense probably damaging 0.97
R7407:Tenm4 UTSW 7 96,423,194 (GRCm39) missense possibly damaging 0.89
R7449:Tenm4 UTSW 7 96,523,420 (GRCm39) missense possibly damaging 0.65
R7473:Tenm4 UTSW 7 96,423,353 (GRCm39) missense probably damaging 1.00
R7477:Tenm4 UTSW 7 96,495,015 (GRCm39) missense probably damaging 0.99
R7489:Tenm4 UTSW 7 96,486,521 (GRCm39) missense possibly damaging 0.90
R7498:Tenm4 UTSW 7 96,497,224 (GRCm39) missense probably damaging 1.00
R7562:Tenm4 UTSW 7 96,538,021 (GRCm39) missense probably damaging 1.00
R7615:Tenm4 UTSW 7 96,495,133 (GRCm39) missense probably damaging 1.00
R7624:Tenm4 UTSW 7 96,545,192 (GRCm39) missense possibly damaging 0.95
R7626:Tenm4 UTSW 7 96,542,221 (GRCm39) missense probably damaging 1.00
R7690:Tenm4 UTSW 7 96,512,740 (GRCm39) missense probably benign 0.00
R7692:Tenm4 UTSW 7 96,544,610 (GRCm39) missense probably damaging 1.00
R7748:Tenm4 UTSW 7 96,543,909 (GRCm39) missense probably damaging 1.00
R7763:Tenm4 UTSW 7 96,544,899 (GRCm39) missense probably benign 0.38
R7792:Tenm4 UTSW 7 96,423,221 (GRCm39) missense possibly damaging 0.54
R7855:Tenm4 UTSW 7 96,523,081 (GRCm39) missense probably damaging 1.00
R7868:Tenm4 UTSW 7 96,555,587 (GRCm39) missense possibly damaging 0.79
R7878:Tenm4 UTSW 7 96,501,564 (GRCm39) missense probably damaging 1.00
R7997:Tenm4 UTSW 7 96,523,512 (GRCm39) missense probably benign 0.44
R8017:Tenm4 UTSW 7 96,353,248 (GRCm39) missense probably damaging 1.00
R8019:Tenm4 UTSW 7 96,353,248 (GRCm39) missense probably damaging 1.00
R8054:Tenm4 UTSW 7 96,378,553 (GRCm39) splice site probably benign
R8061:Tenm4 UTSW 7 96,501,663 (GRCm39) missense probably damaging 1.00
R8108:Tenm4 UTSW 7 96,503,935 (GRCm39) missense probably benign 0.39
R8140:Tenm4 UTSW 7 96,544,383 (GRCm39) missense probably damaging 1.00
R8214:Tenm4 UTSW 7 96,544,614 (GRCm39) missense probably damaging 1.00
R8258:Tenm4 UTSW 7 96,517,198 (GRCm39) missense probably damaging 1.00
R8259:Tenm4 UTSW 7 96,517,198 (GRCm39) missense probably damaging 1.00
R8364:Tenm4 UTSW 7 96,421,313 (GRCm39) critical splice donor site probably null
R8542:Tenm4 UTSW 7 96,461,139 (GRCm39) missense probably damaging 0.99
R8669:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8670:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8683:Tenm4 UTSW 7 96,552,064 (GRCm39) missense probably damaging 0.99
R8691:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8692:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8714:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8716:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8735:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8736:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8737:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8738:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8738:Tenm4 UTSW 7 96,523,047 (GRCm39) missense probably damaging 1.00
R8739:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8776:Tenm4 UTSW 7 96,544,239 (GRCm39) missense probably damaging 1.00
R8776-TAIL:Tenm4 UTSW 7 96,544,239 (GRCm39) missense probably damaging 1.00
R8777:Tenm4 UTSW 7 96,545,244 (GRCm39) missense probably damaging 1.00
R8777-TAIL:Tenm4 UTSW 7 96,545,244 (GRCm39) missense probably damaging 1.00
R8817:Tenm4 UTSW 7 96,523,335 (GRCm39) missense probably benign 0.01
R8851:Tenm4 UTSW 7 96,501,710 (GRCm39) missense probably damaging 1.00
R8913:Tenm4 UTSW 7 96,351,952 (GRCm39) splice site probably benign
R8977:Tenm4 UTSW 7 96,461,177 (GRCm39) missense probably damaging 1.00
R9100:Tenm4 UTSW 7 96,495,061 (GRCm39) missense probably damaging 1.00
R9136:Tenm4 UTSW 7 96,473,125 (GRCm39) missense possibly damaging 0.69
R9163:Tenm4 UTSW 7 96,473,080 (GRCm39) missense probably damaging 1.00
R9188:Tenm4 UTSW 7 96,421,234 (GRCm39) missense probably damaging 1.00
R9195:Tenm4 UTSW 7 96,542,126 (GRCm39) missense probably damaging 1.00
R9217:Tenm4 UTSW 7 96,534,646 (GRCm39) missense probably damaging 1.00
R9344:Tenm4 UTSW 7 96,545,352 (GRCm39) missense probably damaging 1.00
R9414:Tenm4 UTSW 7 96,545,367 (GRCm39) missense probably benign
R9466:Tenm4 UTSW 7 96,199,252 (GRCm39) missense possibly damaging 0.79
R9559:Tenm4 UTSW 7 96,473,056 (GRCm39) missense probably benign
R9626:Tenm4 UTSW 7 96,545,345 (GRCm39) missense probably damaging 1.00
R9673:Tenm4 UTSW 7 96,517,196 (GRCm39) missense probably damaging 1.00
R9676:Tenm4 UTSW 7 96,544,638 (GRCm39) missense probably damaging 1.00
R9678:Tenm4 UTSW 7 96,386,619 (GRCm39) missense possibly damaging 0.94
R9775:Tenm4 UTSW 7 96,555,761 (GRCm39) missense possibly damaging 0.92
R9790:Tenm4 UTSW 7 96,538,046 (GRCm39) missense probably damaging 1.00
R9791:Tenm4 UTSW 7 96,538,046 (GRCm39) missense probably damaging 1.00
R9803:Tenm4 UTSW 7 96,202,685 (GRCm39) missense probably damaging 1.00
X0021:Tenm4 UTSW 7 96,523,116 (GRCm39) nonsense probably null
X0026:Tenm4 UTSW 7 96,517,294 (GRCm39) missense probably damaging 0.98
X0066:Tenm4 UTSW 7 96,544,001 (GRCm39) missense probably damaging 1.00
X0066:Tenm4 UTSW 7 96,497,237 (GRCm39) missense probably damaging 1.00
Z1176:Tenm4 UTSW 7 96,555,121 (GRCm39) missense probably benign 0.00
Z1177:Tenm4 UTSW 7 96,512,792 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAAGATGGATGAGGATGGCTTCC -3'
(R):5'- CCCATAGGCCGTGTATAGGATC -3'

Sequencing Primer
(F):5'- CTTCCTGAGGCAGCGGG -3'
(R):5'- GGATCTGCTTAATCATCAAGCCAG -3'
Posted On 2015-08-18