Incidental Mutation 'R4543:Barx2'
ID333628
Institutional Source Beutler Lab
Gene Symbol Barx2
Ensembl Gene ENSMUSG00000032033
Gene NameBarH-like homeobox 2
Synonyms2310006E12Rik, Barx2b
MMRRC Submission 041778-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.678) question?
Stock #R4543 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location31846044-31913462 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31846796 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 282 (L282S)
Ref Sequence ENSEMBL: ENSMUSP00000112314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000116615]
Predicted Effect unknown
Transcript: ENSMUST00000116615
AA Change: L282S
SMART Domains Protein: ENSMUSP00000112314
Gene: ENSMUSG00000032033
AA Change: L282S

DomainStartEndE-ValueType
low complexity region 103 113 N/A INTRINSIC
HOX 137 199 3.2e-25 SMART
low complexity region 230 246 N/A INTRINSIC
low complexity region 268 283 N/A INTRINSIC
Meta Mutation Damage Score 0.0873 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 94% (44/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the homeobox transcription factor family. A highly related protein in mouse has been shown to influence cellular processes that control cell adhesion and remodeling of the actin cytoskeleton in myoblast fusion and chondrogenesis. The encoded protein may also play a role in cancer progression. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted gene deletion exhibit short whiskers at birth, defective juvenile hair follicle remodeling, and short adult hair. Fifty percent of homozygotes are born with open eyelids. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik T A 1: 134,389,793 M101K probably benign Het
A1bg A T 15: 60,917,900 S500T probably damaging Het
Abhd3 T C 18: 10,706,672 D2G possibly damaging Het
Ablim1 C T 19: 57,077,442 R366H possibly damaging Het
Adgre1 T A 17: 57,406,874 H186Q probably benign Het
Ankmy1 G T 1: 92,884,850 A579E probably damaging Het
Ap2b1 C A 11: 83,324,650 T140K probably damaging Het
Arhgef28 T A 13: 98,075,000 E158D probably benign Het
Atp8b4 A G 2: 126,358,066 F885L probably damaging Het
Catsper2 C T 2: 121,407,409 W163* probably null Het
Cep295 T C 9: 15,335,253 T588A possibly damaging Het
Chil3 T G 3: 106,160,370 K160Q probably benign Het
Clca3a1 T A 3: 144,746,988 Q578L probably damaging Het
Crp A C 1: 172,698,737 I130L probably benign Het
Dtwd2 C A 18: 49,724,108 probably null Het
Fads3 T C 19: 10,041,811 F27S possibly damaging Het
Gm3604 T C 13: 62,370,156 D109G probably benign Het
Gtf2ird1 A G 5: 134,363,900 probably null Het
H2-K1 C T 17: 33,999,558 probably null Het
Hdac5 T C 11: 102,213,944 probably benign Het
Il6st G A 13: 112,481,459 V136M probably damaging Het
Immt T C 6: 71,851,778 S106P probably damaging Het
Kat2b T C 17: 53,653,140 I492T probably benign Het
Kcnn2 T C 18: 45,559,648 F97S probably benign Het
Kdm4c A G 4: 74,330,760 I84V probably benign Het
Kif7 G A 7: 79,707,548 P637S probably benign Het
Lrrcc1 T A 3: 14,539,791 I109K probably damaging Het
Med12l T A 3: 59,091,508 C619S probably damaging Het
Olfr919 A G 9: 38,697,545 S274P possibly damaging Het
Polq T C 16: 37,060,785 C1104R probably benign Het
Rbfox2 A T 15: 77,306,368 M59K probably benign Het
Rft1 T C 14: 30,661,333 V110A probably benign Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,922 probably benign Het
Slc2a12 T A 10: 22,664,786 V180D probably damaging Het
Sox21 CCAGCGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCGGC CCAGCGGCGGCGGCGGCAGCGGC 14: 118,235,136 probably benign Het
Stap2 C T 17: 55,997,604 probably null Het
Tenm4 A G 7: 96,895,815 N2375S probably benign Het
Tmem132c A G 5: 127,504,977 T419A probably benign Het
Tmprss11a G A 5: 86,411,809 Q375* probably null Het
Trav12-3 CTCTG CTCTGTCTG 14: 53,622,236 probably null Het
Vmn1r88 T A 7: 13,177,980 S88T possibly damaging Het
Zfp622 T A 15: 25,991,537 D143E possibly damaging Het
Other mutations in Barx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Barx2 APN 9 31846845 missense unknown
IGL02045:Barx2 APN 9 31858798 missense probably damaging 1.00
IGL03341:Barx2 APN 9 31858794 missense probably damaging 1.00
R1401:Barx2 UTSW 9 31859031 missense probably damaging 1.00
R1982:Barx2 UTSW 9 31913012 missense probably damaging 1.00
R2436:Barx2 UTSW 9 31913087 missense probably damaging 0.99
R4804:Barx2 UTSW 9 31846812 missense unknown
R5399:Barx2 UTSW 9 31854111 critical splice donor site probably null
R5436:Barx2 UTSW 9 31912989 missense probably damaging 1.00
R5700:Barx2 UTSW 9 31858765 missense probably damaging 1.00
R6036:Barx2 UTSW 9 31913008 missense probably damaging 1.00
R6036:Barx2 UTSW 9 31913008 missense probably damaging 1.00
R6042:Barx2 UTSW 9 31846903 missense probably benign 0.35
R6533:Barx2 UTSW 9 31912979 missense probably damaging 1.00
R6618:Barx2 UTSW 9 31846872 missense probably benign 0.01
R8242:Barx2 UTSW 9 31912931 missense probably damaging 1.00
R8307:Barx2 UTSW 9 31859011 missense probably damaging 1.00
R8507:Barx2 UTSW 9 31859013 missense probably damaging 1.00
Z1088:Barx2 UTSW 9 31846866 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- TCCCACACAATCGAGTCTTC -3'
(R):5'- GGCGCCCTAAGAAGAATTCC -3'

Sequencing Primer
(F):5'- GAGTCTTCATCAAATGCTTCCGATG -3'
(R):5'- TTCCCACATCAGAGGAGATTG -3'
Posted On2015-08-18