Mutagenetix > Incidental Mutation

Incidental Mutation 'R4543:Ap2b1'

333631

Institutional Source

Beutler Lab

Gene Symbol

Ap2b1

Ensembl Gene

ENSMUSG00000035152

Gene Name

adaptor-related protein complex 2, beta 1 subunit

Synonyms

1300012O03Rik

MMRRC Submission

041778-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4543 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83299024-83405035 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 83324650 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 140 (T140K)

Ref Sequence

ENSEMBL: ENSMUSP00000134798 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018875] [ENSMUST00000065692] [ENSMUST00000176430] [ENSMUST00000176523] [ENSMUST00000176944]

AlphaFold

Q9DBG3

Predicted Effect

probably damaging
Transcript: ENSMUST00000018875
AA Change: T140K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000018875
Gene: ENSMUSG00000035152
AA Change: T140K

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	2.6e-173	PFAM
Pfam:HEAT_2	88	157	3.7e-8	PFAM
Pfam:Cnd1	99	268	2.1e-40	PFAM
Pfam:HEAT_2	124	219	1.4e-9	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	654	675	N/A	INTRINSIC
Alpha_adaptinC2	721	831	2.94e-18	SMART
B2-adapt-app_C	840	950	9.93e-56	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000065692
AA Change: T140K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000070714
Gene: ENSMUSG00000035152
AA Change: T140K

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	4.2e-173	PFAM
Pfam:HEAT_2	88	157	2.7e-8	PFAM
Pfam:Cnd1	99	268	1.5e-37	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	653	665	N/A	INTRINSIC
Alpha_adaptinC2	707	817	2.94e-18	SMART
B2-adapt-app_C	826	936	9.93e-56	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132178

Predicted Effect

probably damaging
Transcript: ENSMUST00000176430
AA Change: T140K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134779
Gene: ENSMUSG00000035152
AA Change: T140K

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	4e-173	PFAM
Pfam:HEAT_2	88	157	2.8e-8	PFAM
Pfam:Cnd1	99	268	1.5e-37	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	654	675	N/A	INTRINSIC
Alpha_adaptinC2	721	831	2.94e-18	SMART
B2-adapt-app_C	840	936	7.22e-35	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000176523
AA Change: T102K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000135445
Gene: ENSMUSG00000035152
AA Change: T102K

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	95	1.1e-26	PFAM
Pfam:Cnd1	69	230	1.5e-26	PFAM
Pfam:HEAT_2	85	182	5.1e-9	PFAM
Pfam:Adaptin_N	90	496	4e-125	PFAM
low complexity region	587	605	N/A	INTRINSIC
low complexity region	616	637	N/A	INTRINSIC
Alpha_adaptinC2	683	793	2.94e-18	SMART
B2-adapt-app_C	802	912	9.93e-56	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000176944
AA Change: T140K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134798
Gene: ENSMUSG00000035152
AA Change: T140K

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	199	3.4e-67	PFAM
Pfam:DNA_alkylation	18	196	4.6e-8	PFAM
Pfam:HEAT_2	88	185	3.1e-13	PFAM
Pfam:Cnd1	99	198	4.2e-27	PFAM
Pfam:HEAT	122	151	1.4e-5	PFAM

Meta Mutation Damage Score

0.7063

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

94% (44/47)

MGI Phenotype

PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933406M09Rik	T	A	1: 134,389,793	M101K	probably benign	Het
A1bg	A	T	15: 60,917,900	S500T	probably damaging	Het
Abhd3	T	C	18: 10,706,672	D2G	possibly damaging	Het
Ablim1	C	T	19: 57,077,442	R366H	possibly damaging	Het
Adgre1	T	A	17: 57,406,874	H186Q	probably benign	Het
Ankmy1	G	T	1: 92,884,850	A579E	probably damaging	Het
Arhgef28	T	A	13: 98,075,000	E158D	probably benign	Het
Atp8b4	A	G	2: 126,358,066	F885L	probably damaging	Het
Barx2	A	G	9: 31,846,796	L282S	unknown	Het
Catsper2	C	T	2: 121,407,409	W163*	probably null	Het
Cep295	T	C	9: 15,335,253	T588A	possibly damaging	Het
Chil3	T	G	3: 106,160,370	K160Q	probably benign	Het
Clca3a1	T	A	3: 144,746,988	Q578L	probably damaging	Het
Crp	A	C	1: 172,698,737	I130L	probably benign	Het
Dtwd2	C	A	18: 49,724,108		probably null	Het
Fads3	T	C	19: 10,041,811	F27S	possibly damaging	Het
Gm3604	T	C	13: 62,370,156	D109G	probably benign	Het
Gtf2ird1	A	G	5: 134,363,900		probably null	Het
H2-K1	C	T	17: 33,999,558		probably null	Het
Hdac5	T	C	11: 102,213,944		probably benign	Het
Il6st	G	A	13: 112,481,459	V136M	probably damaging	Het
Immt	T	C	6: 71,851,778	S106P	probably damaging	Het
Kat2b	T	C	17: 53,653,140	I492T	probably benign	Het
Kcnn2	T	C	18: 45,559,648	F97S	probably benign	Het
Kdm4c	A	G	4: 74,330,760	I84V	probably benign	Het
Kif7	G	A	7: 79,707,548	P637S	probably benign	Het
Lrrcc1	T	A	3: 14,539,791	I109K	probably damaging	Het
Med12l	T	A	3: 59,091,508	C619S	probably damaging	Het
Olfr919	A	G	9: 38,697,545	S274P	possibly damaging	Het
Polq	T	C	16: 37,060,785	C1104R	probably benign	Het
Rbfox2	A	T	15: 77,306,368	M59K	probably benign	Het
Rft1	T	C	14: 30,661,333	V110A	probably benign	Het
Rsf1	GCGGCGGCG	GCGGCGGCGTCGGCGGCG	7: 97,579,922		probably benign	Het
Slc2a12	T	A	10: 22,664,786	V180D	probably damaging	Het
Sox21	CCAGCGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCGGC	CCAGCGGCGGCGGCGGCAGCGGC	14: 118,235,136		probably benign	Het
Stap2	C	T	17: 55,997,604		probably null	Het
Tenm4	A	G	7: 96,895,815	N2375S	probably benign	Het
Tmem132c	A	G	5: 127,504,977	T419A	probably benign	Het
Tmprss11a	G	A	5: 86,411,809	Q375*	probably null	Het
Trav12-3	CTCTG	CTCTGTCTG	14: 53,622,236		probably null	Het
Vmn1r88	T	A	7: 13,177,980	S88T	possibly damaging	Het
Zfp622	T	A	15: 25,991,537	D143E	possibly damaging	Het

Other mutations in Ap2b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00864:Ap2b1	APN	11	83333158	missense	probably damaging	0.99
IGL01583:Ap2b1	APN	11	83324611	missense	possibly damaging	0.61
IGL01753:Ap2b1	APN	11	83321973	missense	probably damaging	1.00
IGL01992:Ap2b1	APN	11	83335530	missense	probably damaging	1.00
IGL02192:Ap2b1	APN	11	83346766	missense	possibly damaging	0.48
IGL02315:Ap2b1	APN	11	83336799	missense	probably damaging	0.96
IGL03235:Ap2b1	APN	11	83341384	missense	probably benign	0.41
P0045:Ap2b1	UTSW	11	83368026	missense	probably damaging	1.00
R0121:Ap2b1	UTSW	11	83321967	missense	possibly damaging	0.66
R0334:Ap2b1	UTSW	11	83367874	splice site	probably benign
R1222:Ap2b1	UTSW	11	83346738	missense	probably benign	0.06
R1297:Ap2b1	UTSW	11	83333109	missense	probably damaging	1.00
R1653:Ap2b1	UTSW	11	83346831	missense	probably damaging	1.00
R1719:Ap2b1	UTSW	11	83324604	missense	probably damaging	1.00
R1885:Ap2b1	UTSW	11	83390735	missense	probably damaging	0.99
R1886:Ap2b1	UTSW	11	83390735	missense	probably damaging	0.99
R1965:Ap2b1	UTSW	11	83346895	missense	probably benign	0.00
R1966:Ap2b1	UTSW	11	83346895	missense	probably benign	0.00
R2046:Ap2b1	UTSW	11	83336386	missense	probably benign	0.14
R2086:Ap2b1	UTSW	11	83351118	missense	possibly damaging	0.88
R2132:Ap2b1	UTSW	11	83324761	splice site	probably benign
R3615:Ap2b1	UTSW	11	83324565	missense	possibly damaging	0.84
R3616:Ap2b1	UTSW	11	83324565	missense	possibly damaging	0.84
R3983:Ap2b1	UTSW	11	83390716	missense	probably damaging	1.00
R4124:Ap2b1	UTSW	11	83365645	critical splice acceptor site	probably null
R4125:Ap2b1	UTSW	11	83365645	critical splice acceptor site	probably null
R4198:Ap2b1	UTSW	11	83342603	missense	probably damaging	1.00
R4202:Ap2b1	UTSW	11	83335604	critical splice donor site	probably null
R4583:Ap2b1	UTSW	11	83397779	missense	probably benign	0.00
R4589:Ap2b1	UTSW	11	83333011	nonsense	probably null
R4916:Ap2b1	UTSW	11	83390706	missense	probably damaging	1.00
R5005:Ap2b1	UTSW	11	83339392	missense	probably damaging	1.00
R5385:Ap2b1	UTSW	11	83342601	missense	probably damaging	1.00
R5510:Ap2b1	UTSW	11	83336737	splice site	probably null
R5738:Ap2b1	UTSW	11	83336430	splice site	probably null
R6023:Ap2b1	UTSW	11	83335398	missense	probably damaging	0.99
R6269:Ap2b1	UTSW	11	83346673	missense	probably damaging	1.00
R6383:Ap2b1	UTSW	11	83346825	missense	probably damaging	1.00
R6416:Ap2b1	UTSW	11	83308239	start codon destroyed	probably null	1.00
R6502:Ap2b1	UTSW	11	83342679	missense	probably damaging	0.97
R6810:Ap2b1	UTSW	11	83335491	missense	possibly damaging	0.89
R6969:Ap2b1	UTSW	11	83389726	missense	probably damaging	0.99
R7238:Ap2b1	UTSW	11	83333122	missense	possibly damaging	0.91
R7241:Ap2b1	UTSW	11	83351105	missense	probably benign	0.16
R7429:Ap2b1	UTSW	11	83367998	missense	probably benign	0.00
R7588:Ap2b1	UTSW	11	83324522	missense	probably benign	0.00
R7635:Ap2b1	UTSW	11	83389728	missense	probably benign	0.09
R7651:Ap2b1	UTSW	11	83339430	critical splice donor site	probably null
R7753:Ap2b1	UTSW	11	83367907	nonsense	probably null
R8468:Ap2b1	UTSW	11	83351065	missense	probably damaging	1.00
R8943:Ap2b1	UTSW	11	83346753	missense	probably damaging	1.00
R9093:Ap2b1	UTSW	11	83324569	missense	probably damaging	1.00
R9621:Ap2b1	UTSW	11	83402598	missense	probably damaging	1.00
X0064:Ap2b1	UTSW	11	83324569	missense	probably damaging	1.00
Z1177:Ap2b1	UTSW	11	83365753	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCTGGAATGTTGGCTTGTAATCAC -3'
(R):5'- CTCCAAGACAATGCTTGTGCC -3'

Sequencing Primer
(F):5'- GTTGGCTTGTAATCACCTTGTATTC -3'
(R):5'- CAAGCATGCCTTGGAACG -3'

Posted On

2015-08-18