Incidental Mutation 'R4543:Il6st'
ID333633
Institutional Source Beutler Lab
Gene Symbol Il6st
Ensembl Gene ENSMUSG00000021756
Gene Nameinterleukin 6 signal transducer
SynonymsD13Ertd699e, gp130, CD130, 5133400A03Rik
MMRRC Submission 041778-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4543 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location112464070-112510086 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 112481459 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 136 (V136M)
Ref Sequence ENSEMBL: ENSMUSP00000138915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070731] [ENSMUST00000183513] [ENSMUST00000183663] [ENSMUST00000183829] [ENSMUST00000183868] [ENSMUST00000183886] [ENSMUST00000184276] [ENSMUST00000184311] [ENSMUST00000184445] [ENSMUST00000184949]
Predicted Effect probably damaging
Transcript: ENSMUST00000070731
AA Change: V136M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064205
Gene: ENSMUSG00000021756
AA Change: V136M

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 26 112 1.4e-30 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
FN3 324 407 1.07e1 SMART
FN3 422 503 6.1e0 SMART
FN3 517 600 4.81e-4 SMART
transmembrane domain 618 640 N/A INTRINSIC
low complexity region 718 753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183513
SMART Domains Protein: ENSMUSP00000139016
Gene: ENSMUSG00000021756

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183663
AA Change: V136M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138836
Gene: ENSMUSG00000021756
AA Change: V136M

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 24 114 1.2e-32 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
FN3 324 407 1.07e1 SMART
FN3 422 503 6.1e0 SMART
FN3 517 600 4.81e-4 SMART
transmembrane domain 618 640 N/A INTRINSIC
low complexity region 718 753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183829
SMART Domains Protein: ENSMUSP00000138987
Gene: ENSMUSG00000021756

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PDB:1I1R|A 23 52 7e-8 PDB
FN3 56 142 7.23e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183868
Predicted Effect probably damaging
Transcript: ENSMUST00000183886
AA Change: V136M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138820
Gene: ENSMUSG00000021756
AA Change: V136M

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 24 114 4.3e-34 PFAM
Pfam:IL6Ra-bind 128 163 3e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000184276
AA Change: V136M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139060
Gene: ENSMUSG00000021756
AA Change: V136M

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 24 114 2.3e-33 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184311
AA Change: V136M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139227
Gene: ENSMUSG00000021756
AA Change: V136M

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 24 114 1.2e-32 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
FN3 324 407 1.07e1 SMART
FN3 422 503 6.1e0 SMART
FN3 517 600 4.81e-4 SMART
transmembrane domain 618 640 N/A INTRINSIC
low complexity region 718 753 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000184445
AA Change: V136M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139311
Gene: ENSMUSG00000021756
AA Change: V136M

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 24 114 2e-33 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184949
AA Change: V136M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138915
Gene: ENSMUSG00000021756
AA Change: V136M

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 24 114 9.4e-33 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
FN3 324 442 6.97e0 SMART
FN3 456 539 4.81e-4 SMART
transmembrane domain 557 579 N/A INTRINSIC
low complexity region 657 692 N/A INTRINSIC
Meta Mutation Damage Score 0.1275 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 94% (44/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a signal transducer shared by many cytokines, including interleukin 6 (IL6), ciliary neurotrophic factor (CNTF), leukemia inhibitory factor (LIF), and oncostatin M (OSM). This protein functions as a part of the cytokine receptor complex. The activation of this protein is dependent upon the binding of cytokines to their receptors. vIL6, a protein related to IL6 and encoded by the Kaposi sarcoma-associated herpesvirus, can bypass the interleukin 6 receptor (IL6R) and directly activate this protein. Knockout studies in mice suggest that this gene plays a critical role in regulating myocyte apoptosis. Alternatively spliced transcript variants have been described. A related pseudogene has been identified on chromosome 17. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for targeted null mutations show myocardial and hematological defects and die between embryonic day 12.5 and term. Conditional mutants show female infertility and neurological, cardiac, hematopoietic, immunological, hepatic, and lung defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik T A 1: 134,389,793 M101K probably benign Het
A1bg A T 15: 60,917,900 S500T probably damaging Het
Abhd3 T C 18: 10,706,672 D2G possibly damaging Het
Ablim1 C T 19: 57,077,442 R366H possibly damaging Het
Adgre1 T A 17: 57,406,874 H186Q probably benign Het
Ankmy1 G T 1: 92,884,850 A579E probably damaging Het
Ap2b1 C A 11: 83,324,650 T140K probably damaging Het
Arhgef28 T A 13: 98,075,000 E158D probably benign Het
Atp8b4 A G 2: 126,358,066 F885L probably damaging Het
Barx2 A G 9: 31,846,796 L282S unknown Het
Catsper2 C T 2: 121,407,409 W163* probably null Het
Cep295 T C 9: 15,335,253 T588A possibly damaging Het
Chil3 T G 3: 106,160,370 K160Q probably benign Het
Clca3a1 T A 3: 144,746,988 Q578L probably damaging Het
Crp A C 1: 172,698,737 I130L probably benign Het
Dtwd2 C A 18: 49,724,108 probably null Het
Fads3 T C 19: 10,041,811 F27S possibly damaging Het
Gm3604 T C 13: 62,370,156 D109G probably benign Het
Gtf2ird1 A G 5: 134,363,900 probably null Het
H2-K1 C T 17: 33,999,558 probably null Het
Hdac5 T C 11: 102,213,944 probably benign Het
Immt T C 6: 71,851,778 S106P probably damaging Het
Kat2b T C 17: 53,653,140 I492T probably benign Het
Kcnn2 T C 18: 45,559,648 F97S probably benign Het
Kdm4c A G 4: 74,330,760 I84V probably benign Het
Kif7 G A 7: 79,707,548 P637S probably benign Het
Lrrcc1 T A 3: 14,539,791 I109K probably damaging Het
Med12l T A 3: 59,091,508 C619S probably damaging Het
Olfr919 A G 9: 38,697,545 S274P possibly damaging Het
Polq T C 16: 37,060,785 C1104R probably benign Het
Rbfox2 A T 15: 77,306,368 M59K probably benign Het
Rft1 T C 14: 30,661,333 V110A probably benign Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,922 probably benign Het
Slc2a12 T A 10: 22,664,786 V180D probably damaging Het
Sox21 CCAGCGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCGGC CCAGCGGCGGCGGCGGCAGCGGC 14: 118,235,136 probably benign Het
Stap2 C T 17: 55,997,604 probably null Het
Tenm4 A G 7: 96,895,815 N2375S probably benign Het
Tmem132c A G 5: 127,504,977 T419A probably benign Het
Tmprss11a G A 5: 86,411,809 Q375* probably null Het
Trav12-3 CTCTG CTCTGTCTG 14: 53,622,236 probably null Het
Vmn1r88 T A 7: 13,177,980 S88T possibly damaging Het
Zfp622 T A 15: 25,991,537 D143E possibly damaging Het
Other mutations in Il6st
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Il6st APN 13 112481433 unclassified probably null
IGL00571:Il6st APN 13 112487860 missense probably damaging 1.00
IGL01151:Il6st APN 13 112493651 missense probably benign 0.00
IGL01336:Il6st APN 13 112480239 missense possibly damaging 0.71
IGL01501:Il6st APN 13 112480059 missense probably benign 0.22
IGL01512:Il6st APN 13 112504366 missense probably benign 0.36
IGL01657:Il6st APN 13 112481543 missense probably damaging 1.00
IGL01863:Il6st APN 13 112504210 missense possibly damaging 0.88
IGL01916:Il6st APN 13 112480072 missense possibly damaging 0.90
IGL01978:Il6st APN 13 112497357 missense possibly damaging 0.51
IGL02089:Il6st APN 13 112495240 missense probably benign 0.12
IGL02752:Il6st APN 13 112480195 missense probably damaging 0.98
IGL02988:Il6st UTSW 13 112498886 missense probably damaging 1.00
R0019:Il6st UTSW 13 112501148 missense possibly damaging 0.94
R0550:Il6st UTSW 13 112475114 splice site probably null
R0606:Il6st UTSW 13 112504272 missense possibly damaging 0.78
R1126:Il6st UTSW 13 112503732 missense probably damaging 1.00
R1452:Il6st UTSW 13 112481464 missense possibly damaging 0.79
R1581:Il6st UTSW 13 112481541 missense probably damaging 0.99
R1632:Il6st UTSW 13 112504332 missense possibly damaging 0.86
R1881:Il6st UTSW 13 112504413 missense probably damaging 1.00
R2013:Il6st UTSW 13 112498889 missense probably null 0.94
R2043:Il6st UTSW 13 112480219 missense probably benign 0.00
R2128:Il6st UTSW 13 112504175 missense probably benign 0.01
R2137:Il6st UTSW 13 112502858 missense possibly damaging 0.92
R3433:Il6st UTSW 13 112503831 missense probably damaging 1.00
R3696:Il6st UTSW 13 112504382 missense probably benign 0.13
R3697:Il6st UTSW 13 112504382 missense probably benign 0.13
R3698:Il6st UTSW 13 112504382 missense probably benign 0.13
R4172:Il6st UTSW 13 112495327 missense probably benign 0.25
R4641:Il6st UTSW 13 112488530 missense probably damaging 1.00
R4838:Il6st UTSW 13 112490510 nonsense probably null
R4899:Il6st UTSW 13 112501161 missense probably damaging 1.00
R4922:Il6st UTSW 13 112502865 missense probably damaging 0.98
R5088:Il6st UTSW 13 112490555 missense probably damaging 1.00
R5104:Il6st UTSW 13 112488648 missense probably benign 0.02
R5853:Il6st UTSW 13 112481537 missense probably damaging 1.00
R6602:Il6st UTSW 13 112504413 missense probably damaging 1.00
R7082:Il6st UTSW 13 112504032 missense probably damaging 1.00
R7101:Il6st UTSW 13 112495373 critical splice donor site probably null
R7192:Il6st UTSW 13 112495207 missense probably benign 0.00
R7273:Il6st UTSW 13 112495298 missense probably benign 0.37
R7330:Il6st UTSW 13 112493651 missense probably benign 0.00
R7427:Il6st UTSW 13 112488560 missense probably benign 0.01
R7770:Il6st UTSW 13 112502804 missense probably damaging 1.00
U24488:Il6st UTSW 13 112494634 missense possibly damaging 0.90
Z1176:Il6st UTSW 13 112493618 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTCCTACAACGACCTTTTAATACTAG -3'
(R):5'- CGTGATGTCCCAAAACAGTC -3'

Sequencing Primer
(F):5'- GAAAGCAATTAAAGACAGTTACACAC -3'
(R):5'- GTCACCCAGTACTGCTACCG -3'
Posted On2015-08-18