Incidental Mutation 'R0207:Tpr'
ID33365
Institutional Source Beutler Lab
Gene Symbol Tpr
Ensembl Gene ENSMUSG00000006005
Gene Nametranslocated promoter region, nuclear basket protein
Synonyms2610029M07Rik
MMRRC Submission 038460-MU
Accession Numbers

Genbank: NM_133780; MGI: 1922066

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0207 (G1)
Quality Score224
Status Validated
Chromosome1
Chromosomal Location150392838-150449935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 150417427 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 868 (S868P)
Ref Sequence ENSEMBL: ENSMUSP00000117616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119161] [ENSMUST00000124973]
Predicted Effect possibly damaging
Transcript: ENSMUST00000119161
AA Change: S794P

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112606
Gene: ENSMUSG00000006005
AA Change: S794P

DomainStartEndE-ValueType
coiled coil region 49 370 N/A INTRINSIC
coiled coil region 423 515 N/A INTRINSIC
low complexity region 518 534 N/A INTRINSIC
coiled coil region 539 604 N/A INTRINSIC
low complexity region 690 703 N/A INTRINSIC
low complexity region 782 795 N/A INTRINSIC
low complexity region 811 826 N/A INTRINSIC
low complexity region 1003 1019 N/A INTRINSIC
Pfam:TPR_MLP1_2 1036 1167 9.1e-33 PFAM
coiled coil region 1215 1421 N/A INTRINSIC
coiled coil region 1473 1629 N/A INTRINSIC
internal_repeat_3 1630 1691 1.48e-5 PROSPERO
low complexity region 1695 1717 N/A INTRINSIC
low complexity region 1761 1777 N/A INTRINSIC
internal_repeat_5 1814 1827 5.58e-5 PROSPERO
internal_repeat_3 1819 1881 1.48e-5 PROSPERO
internal_repeat_4 1875 1895 5.58e-5 PROSPERO
internal_repeat_1 1893 1919 2.03e-6 PROSPERO
low complexity region 1920 1933 N/A INTRINSIC
low complexity region 1942 1981 N/A INTRINSIC
low complexity region 1989 2014 N/A INTRINSIC
internal_repeat_4 2017 2036 5.58e-5 PROSPERO
low complexity region 2059 2078 N/A INTRINSIC
internal_repeat_2 2084 2135 3.95e-6 PROSPERO
internal_repeat_5 2127 2140 5.58e-5 PROSPERO
internal_repeat_1 2154 2179 2.03e-6 PROSPERO
internal_repeat_2 2156 2212 3.95e-6 PROSPERO
low complexity region 2239 2251 N/A INTRINSIC
low complexity region 2263 2277 N/A INTRINSIC
low complexity region 2292 2314 N/A INTRINSIC
low complexity region 2346 2357 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000124973
AA Change: S868P

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000117616
Gene: ENSMUSG00000006005
AA Change: S868P

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 24 77 N/A INTRINSIC
coiled coil region 123 444 N/A INTRINSIC
coiled coil region 497 589 N/A INTRINSIC
low complexity region 592 608 N/A INTRINSIC
coiled coil region 613 678 N/A INTRINSIC
low complexity region 764 777 N/A INTRINSIC
low complexity region 856 869 N/A INTRINSIC
low complexity region 885 900 N/A INTRINSIC
low complexity region 1077 1093 N/A INTRINSIC
Pfam:TPR_MLP1_2 1112 1240 5.1e-37 PFAM
coiled coil region 1289 1495 N/A INTRINSIC
low complexity region 1682 1698 N/A INTRINSIC
internal_repeat_5 1703 1750 8.04e-5 PROSPERO
internal_repeat_3 1704 1765 1.07e-5 PROSPERO
low complexity region 1769 1791 N/A INTRINSIC
low complexity region 1835 1851 N/A INTRINSIC
internal_repeat_5 1857 1900 8.04e-5 PROSPERO
internal_repeat_6 1887 1911 8.04e-5 PROSPERO
internal_repeat_3 1893 1955 1.07e-5 PROSPERO
internal_repeat_4 1949 1969 4.1e-5 PROSPERO
internal_repeat_1 1967 1993 1.42e-6 PROSPERO
low complexity region 1994 2007 N/A INTRINSIC
low complexity region 2016 2055 N/A INTRINSIC
low complexity region 2063 2088 N/A INTRINSIC
internal_repeat_4 2091 2110 4.1e-5 PROSPERO
internal_repeat_6 2108 2132 8.04e-5 PROSPERO
low complexity region 2133 2152 N/A INTRINSIC
internal_repeat_2 2158 2209 2.78e-6 PROSPERO
internal_repeat_1 2228 2253 1.42e-6 PROSPERO
internal_repeat_2 2230 2286 2.78e-6 PROSPERO
low complexity region 2313 2325 N/A INTRINSIC
low complexity region 2337 2351 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2420 2431 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141827
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147769
Meta Mutation Damage Score 0.0604 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.5%
Validation Efficiency 95% (76/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled-coil protein that forms intranuclear filaments attached to the inner surface of nuclear pore complexes (NPCs). The protein directly interacts with several components of the NPC. It is required for the nuclear export of mRNAs and some proteins. Oncogenic fusions of the 5' end of this gene with several different kinase genes occur in some neoplasias. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(28) : Targeted, other(2) Gene trapped(26)

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,086,039 F488S probably damaging Het
Acap3 C T 4: 155,899,424 R116W probably damaging Het
Adamts10 C A 17: 33,545,390 P663T possibly damaging Het
Akap12 G A 10: 4,353,333 G48S probably damaging Het
Ankrd7 T A 6: 18,870,031 M261K probably benign Het
Ankzf1 C A 1: 75,198,304 D599E possibly damaging Het
Aox1 T C 1: 58,105,014 I1278T possibly damaging Het
Apcdd1 T C 18: 62,950,079 Y327H probably benign Het
Asxl3 T A 18: 22,411,496 probably benign Het
Birc6 C A 17: 74,662,832 probably benign Het
Btaf1 T A 19: 37,009,648 L1714* probably null Het
Cacng6 T A 7: 3,425,004 probably benign Het
Cdc20b A G 13: 113,078,612 D238G probably damaging Het
Celf5 T A 10: 81,470,698 R113W probably null Het
Cfap70 C A 14: 20,412,347 E659D probably damaging Het
Clspn T A 4: 126,590,598 M1183K possibly damaging Het
Dpy19l1 G A 9: 24,453,891 R275C probably damaging Het
Dst C T 1: 34,186,935 S1721L probably benign Het
Faap100 T C 11: 120,374,365 T562A probably damaging Het
Fam168b T C 1: 34,819,688 M133V probably damaging Het
Farp2 T C 1: 93,569,087 I172T probably damaging Het
Fer T G 17: 63,896,278 S68A probably damaging Het
Fmo5 A G 3: 97,645,681 E315G probably damaging Het
Gpr89 A T 3: 96,871,480 F426I probably damaging Het
Hinfp T C 9: 44,296,327 I461V possibly damaging Het
Hsd11b1 A T 1: 193,240,248 V167D probably damaging Het
Htt A G 5: 34,896,908 K2574E probably benign Het
I830077J02Rik A G 3: 105,926,505 S112P probably benign Het
Igf2bp3 T A 6: 49,105,617 M344L probably benign Het
Itch A T 2: 155,202,257 Q494L probably benign Het
Itga9 T C 9: 118,769,253 probably benign Het
Jaml T A 9: 45,093,767 D152E probably benign Het
Kif22 A C 7: 127,042,400 M1R probably null Het
Kifap3 T C 1: 163,883,386 Y663H probably benign Het
Letm2 T A 8: 25,578,770 N472I probably damaging Het
Mthfr T G 4: 148,052,224 V446G probably damaging Het
Myh11 T C 16: 14,211,260 E1206G possibly damaging Het
Myo6 G A 9: 80,288,056 V903I probably damaging Het
Myo9b C T 8: 71,355,225 probably benign Het
Nr2f2 G C 7: 70,360,175 P52R probably damaging Het
Nsd3 A G 8: 25,683,257 N859S probably benign Het
Nucb2 C A 7: 116,536,010 A384E probably damaging Het
Ogdhl C A 14: 32,342,037 probably null Het
Olfr119 C A 17: 37,701,058 C129* probably null Het
Olfr1247 G A 2: 89,609,863 L80F probably damaging Het
Olfr1357 T C 10: 78,611,871 T257A probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr381 A T 11: 73,486,575 L83Q probably benign Het
Parp10 C T 15: 76,242,633 S145N probably benign Het
Pigh A G 12: 79,083,709 probably benign Het
Pigo A G 4: 43,023,824 probably benign Het
Pkp4 T A 2: 59,305,488 V199D possibly damaging Het
Polr1e C A 4: 45,025,143 probably null Het
Ppfia3 C A 7: 45,348,534 R723L probably damaging Het
Prex1 C A 2: 166,585,898 A945S possibly damaging Het
Prrt3 A T 6: 113,495,840 V457E probably damaging Het
Rab39 A G 9: 53,705,971 F49L possibly damaging Het
Rrs1 C A 1: 9,545,762 probably null Het
Rrs1 G A 1: 9,545,767 E82K probably damaging Het
Serpinb3c T C 1: 107,276,992 D8G probably benign Het
Slc17a6 A G 7: 51,646,180 probably benign Het
Slc24a4 T A 12: 102,228,951 probably null Het
Smc1b C T 15: 85,123,759 M272I probably benign Het
Smc6 T C 12: 11,283,178 probably benign Het
Tcf20 T C 15: 82,855,085 T722A probably benign Het
Tesmin A T 19: 3,404,088 M141L probably benign Het
Tmprss5 T A 9: 49,113,160 H274Q possibly damaging Het
Tns1 C T 1: 73,937,318 probably null Het
Trank1 C T 9: 111,366,253 T1115I probably damaging Het
Trmt44 A T 5: 35,572,917 I203K possibly damaging Het
Ulk2 A T 11: 61,777,785 V1037E probably benign Het
Usp43 A G 11: 67,876,499 Y682H probably damaging Het
Vipr2 A T 12: 116,142,882 Q366L probably damaging Het
Vmn1r185 C A 7: 26,611,589 V164L possibly damaging Het
Vmn2r120 C T 17: 57,525,052 V246I probably benign Het
Wdr66 T C 5: 123,283,447 V182A probably damaging Het
Wiz C T 17: 32,357,033 G790R probably damaging Het
Wnk1 A T 6: 119,952,733 S1016R probably damaging Het
Zc3hav1 A G 6: 38,311,174 L909S probably benign Het
Zfp236 T A 18: 82,640,227 I637F probably damaging Het
Zfp788 G A 7: 41,649,596 G532D probably damaging Het
Zranb1 T C 7: 132,950,385 I255T probably damaging Het
Other mutations in Tpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Tpr APN 1 150423696 splice site probably benign
IGL00424:Tpr APN 1 150398595 splice site probably benign
IGL01095:Tpr APN 1 150410140 missense possibly damaging 0.95
IGL01347:Tpr APN 1 150426987 missense probably damaging 1.00
IGL01519:Tpr APN 1 150431168 missense probably benign 0.01
IGL01768:Tpr APN 1 150444448 missense possibly damaging 0.85
IGL01939:Tpr APN 1 150413745 missense possibly damaging 0.82
IGL01988:Tpr APN 1 150426999 splice site probably null
IGL02065:Tpr APN 1 150413774 missense probably benign 0.13
IGL02110:Tpr APN 1 150435742 missense probably damaging 0.97
IGL02311:Tpr APN 1 150398653 missense probably damaging 0.97
IGL02454:Tpr APN 1 150431192 missense probably benign 0.00
IGL02569:Tpr APN 1 150425631 unclassified probably benign
IGL03168:Tpr APN 1 150408757 missense probably benign 0.04
IGL03193:Tpr APN 1 150440080 missense possibly damaging 0.85
IGL03333:Tpr APN 1 150426967 missense probably benign 0.04
F6893:Tpr UTSW 1 150393562 missense possibly damaging 0.84
PIT4305001:Tpr UTSW 1 150440137 missense possibly damaging 0.85
PIT4469001:Tpr UTSW 1 150403956 missense probably benign 0.41
R0085:Tpr UTSW 1 150417413 missense possibly damaging 0.95
R0101:Tpr UTSW 1 150409302 splice site probably benign
R0116:Tpr UTSW 1 150410147 missense probably damaging 0.98
R0136:Tpr UTSW 1 150430595 missense probably benign 0.01
R0219:Tpr UTSW 1 150443258 splice site probably null
R0380:Tpr UTSW 1 150412947 missense probably benign 0.27
R0403:Tpr UTSW 1 150407414 splice site probably benign
R0469:Tpr UTSW 1 150423667 frame shift probably null
R0480:Tpr UTSW 1 150428241 missense possibly damaging 0.83
R0514:Tpr UTSW 1 150402273 missense possibly damaging 0.55
R0563:Tpr UTSW 1 150408858 missense probably benign 0.13
R0631:Tpr UTSW 1 150422531 missense probably damaging 0.98
R0685:Tpr UTSW 1 150433725 missense possibly damaging 0.69
R0730:Tpr UTSW 1 150393407 utr 5 prime probably benign
R0739:Tpr UTSW 1 150407497 missense possibly damaging 0.94
R0780:Tpr UTSW 1 150431341 missense probably benign 0.00
R1018:Tpr UTSW 1 150442183 missense possibly damaging 0.53
R1084:Tpr UTSW 1 150442161 missense probably benign 0.18
R1532:Tpr UTSW 1 150418000 missense probably damaging 0.99
R1551:Tpr UTSW 1 150436801 missense probably benign 0.00
R1608:Tpr UTSW 1 150426893 missense probably damaging 0.96
R1759:Tpr UTSW 1 150429524 missense probably benign 0.19
R1817:Tpr UTSW 1 150419903 missense probably damaging 0.98
R1932:Tpr UTSW 1 150421663 missense probably benign 0.00
R1978:Tpr UTSW 1 150419907 missense possibly damaging 0.65
R2031:Tpr UTSW 1 150442119 missense probably benign
R2176:Tpr UTSW 1 150419940 missense possibly damaging 0.56
R2235:Tpr UTSW 1 150442092 missense probably benign 0.33
R2339:Tpr UTSW 1 150413774 missense probably benign 0.01
R2367:Tpr UTSW 1 150433728 missense probably damaging 0.99
R2507:Tpr UTSW 1 150392944 start codon destroyed probably null
R3931:Tpr UTSW 1 150435904 missense probably damaging 1.00
R4320:Tpr UTSW 1 150423574 missense possibly damaging 0.96
R4439:Tpr UTSW 1 150403961 missense probably benign 0.01
R4568:Tpr UTSW 1 150392959 unclassified probably benign
R4644:Tpr UTSW 1 150423499 missense probably benign 0.01
R4665:Tpr UTSW 1 150444399 missense probably damaging 0.97
R4672:Tpr UTSW 1 150423567 missense probably benign 0.45
R4673:Tpr UTSW 1 150423567 missense probably benign 0.45
R4735:Tpr UTSW 1 150442196 missense possibly damaging 0.91
R4767:Tpr UTSW 1 150430529 intron probably benign
R4772:Tpr UTSW 1 150413113 missense possibly damaging 0.46
R4815:Tpr UTSW 1 150398608 missense probably benign 0.01
R4839:Tpr UTSW 1 150449197 nonsense probably null
R4844:Tpr UTSW 1 150445879 missense possibly damaging 0.86
R4925:Tpr UTSW 1 150432565 missense probably benign 0.00
R4967:Tpr UTSW 1 150410059 missense probably damaging 0.99
R5017:Tpr UTSW 1 150398637 missense probably benign 0.00
R5096:Tpr UTSW 1 150446202 missense probably damaging 0.99
R5353:Tpr UTSW 1 150445924 missense probably damaging 1.00
R5354:Tpr UTSW 1 150445924 missense probably damaging 1.00
R5484:Tpr UTSW 1 150426888 missense probably benign 0.33
R5601:Tpr UTSW 1 150435853 missense possibly damaging 0.75
R5642:Tpr UTSW 1 150423818 missense probably damaging 0.99
R5779:Tpr UTSW 1 150423541 missense probably damaging 1.00
R5787:Tpr UTSW 1 150395286 missense probably benign 0.01
R5892:Tpr UTSW 1 150407400 missense probably benign 0.44
R5915:Tpr UTSW 1 150425649 missense probably benign 0.15
R5928:Tpr UTSW 1 150428127 missense probably benign 0.30
R6146:Tpr UTSW 1 150423162 missense possibly damaging 0.83
R6154:Tpr UTSW 1 150423816 missense probably benign 0.00
R6234:Tpr UTSW 1 150418039 missense probably benign 0.02
R6263:Tpr UTSW 1 150442245 critical splice donor site probably null
R6318:Tpr UTSW 1 150445888 missense possibly damaging 0.93
R6550:Tpr UTSW 1 150423977 missense probably damaging 1.00
R6592:Tpr UTSW 1 150411905 missense possibly damaging 0.83
R6704:Tpr UTSW 1 150406508 missense possibly damaging 0.80
R6716:Tpr UTSW 1 150414765 missense probably damaging 1.00
R6836:Tpr UTSW 1 150436673 intron probably null
R6886:Tpr UTSW 1 150423965 missense probably benign 0.00
R6894:Tpr UTSW 1 150436847 missense probably benign 0.28
R6928:Tpr UTSW 1 150408785 missense possibly damaging 0.83
R7011:Tpr UTSW 1 150433772 missense probably damaging 1.00
R7034:Tpr UTSW 1 150423607 missense probably benign 0.02
R7036:Tpr UTSW 1 150423607 missense probably benign 0.02
R7183:Tpr UTSW 1 150406551 missense probably damaging 1.00
R7221:Tpr UTSW 1 150446178 missense possibly damaging 0.96
R7223:Tpr UTSW 1 150439256 missense possibly damaging 0.53
R7294:Tpr UTSW 1 150403887 missense probably damaging 1.00
R7343:Tpr UTSW 1 150393494 missense unknown
R7361:Tpr UTSW 1 150447621 missense possibly damaging 0.73
R7405:Tpr UTSW 1 150442127 missense probably benign 0.02
R7637:Tpr UTSW 1 150423516 missense probably damaging 1.00
R7720:Tpr UTSW 1 150429532 missense possibly damaging 0.49
R7721:Tpr UTSW 1 150444429 missense probably benign
R7751:Tpr UTSW 1 150419895 missense probably benign 0.17
R7804:Tpr UTSW 1 150432559 missense probably damaging 0.99
R7878:Tpr UTSW 1 150423660 missense possibly damaging 0.67
R7961:Tpr UTSW 1 150423660 missense possibly damaging 0.67
R8013:Tpr UTSW 1 150398608 missense probably benign
X0021:Tpr UTSW 1 150395207 missense probably damaging 1.00
Z1177:Tpr UTSW 1 150428235 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- agctctttctccagcttcCATTATATTGTTTT -3'
(R):5'- GTCTCAGATCGCTCTAGTATGCCCTAA -3'

Sequencing Primer
(F):5'- GAACAGTTTGCTAGAGCTAAATTAAC -3'
(R):5'- aatatttaGTGGTATGGAATGGGGGC -3'
Posted On2013-05-09