Mutagenetix > Incidental Mutation

Incidental Mutation 'R0207:Tpr'

33365

Institutional Source

Beutler Lab

Gene Symbol

Tpr

Ensembl Gene

ENSMUSG00000006005

Gene Name

translocated promoter region, nuclear basket protein

Synonyms

2610029M07Rik

MMRRC Submission

038460-MU

Accession Numbers

Genbank: NM_133780; MGI: 1922066

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0207 (G1)

Quality Score

224

Status

Validated

Chromosome

Chromosomal Location

150392838-150449935 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 150417427 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 868 (S868P)

Ref Sequence

ENSEMBL: ENSMUSP00000117616 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119161] [ENSMUST00000124973]

AlphaFold

F6ZDS4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000119161
AA Change: S794P

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000112606
Gene: ENSMUSG00000006005
AA Change: S794P

Domain	Start	End	E-Value	Type
coiled coil region	49	370	N/A	INTRINSIC
coiled coil region	423	515	N/A	INTRINSIC
low complexity region	518	534	N/A	INTRINSIC
coiled coil region	539	604	N/A	INTRINSIC
low complexity region	690	703	N/A	INTRINSIC
low complexity region	782	795	N/A	INTRINSIC
low complexity region	811	826	N/A	INTRINSIC
low complexity region	1003	1019	N/A	INTRINSIC
Pfam:TPR_MLP1_2	1036	1167	9.1e-33	PFAM
coiled coil region	1215	1421	N/A	INTRINSIC
coiled coil region	1473	1629	N/A	INTRINSIC
internal_repeat_3	1630	1691	1.48e-5	PROSPERO
low complexity region	1695	1717	N/A	INTRINSIC
low complexity region	1761	1777	N/A	INTRINSIC
internal_repeat_5	1814	1827	5.58e-5	PROSPERO
internal_repeat_3	1819	1881	1.48e-5	PROSPERO
internal_repeat_4	1875	1895	5.58e-5	PROSPERO
internal_repeat_1	1893	1919	2.03e-6	PROSPERO
low complexity region	1920	1933	N/A	INTRINSIC
low complexity region	1942	1981	N/A	INTRINSIC
low complexity region	1989	2014	N/A	INTRINSIC
internal_repeat_4	2017	2036	5.58e-5	PROSPERO
low complexity region	2059	2078	N/A	INTRINSIC
internal_repeat_2	2084	2135	3.95e-6	PROSPERO
internal_repeat_5	2127	2140	5.58e-5	PROSPERO
internal_repeat_1	2154	2179	2.03e-6	PROSPERO
internal_repeat_2	2156	2212	3.95e-6	PROSPERO
low complexity region	2239	2251	N/A	INTRINSIC
low complexity region	2263	2277	N/A	INTRINSIC
low complexity region	2292	2314	N/A	INTRINSIC
low complexity region	2346	2357	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000124973
AA Change: S868P

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000117616
Gene: ENSMUSG00000006005
AA Change: S868P

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
low complexity region	24	77	N/A	INTRINSIC
coiled coil region	123	444	N/A	INTRINSIC
coiled coil region	497	589	N/A	INTRINSIC
low complexity region	592	608	N/A	INTRINSIC
coiled coil region	613	678	N/A	INTRINSIC
low complexity region	764	777	N/A	INTRINSIC
low complexity region	856	869	N/A	INTRINSIC
low complexity region	885	900	N/A	INTRINSIC
low complexity region	1077	1093	N/A	INTRINSIC
Pfam:TPR_MLP1_2	1112	1240	5.1e-37	PFAM
coiled coil region	1289	1495	N/A	INTRINSIC
low complexity region	1682	1698	N/A	INTRINSIC
internal_repeat_5	1703	1750	8.04e-5	PROSPERO
internal_repeat_3	1704	1765	1.07e-5	PROSPERO
low complexity region	1769	1791	N/A	INTRINSIC
low complexity region	1835	1851	N/A	INTRINSIC
internal_repeat_5	1857	1900	8.04e-5	PROSPERO
internal_repeat_6	1887	1911	8.04e-5	PROSPERO
internal_repeat_3	1893	1955	1.07e-5	PROSPERO
internal_repeat_4	1949	1969	4.1e-5	PROSPERO
internal_repeat_1	1967	1993	1.42e-6	PROSPERO
low complexity region	1994	2007	N/A	INTRINSIC
low complexity region	2016	2055	N/A	INTRINSIC
low complexity region	2063	2088	N/A	INTRINSIC
internal_repeat_4	2091	2110	4.1e-5	PROSPERO
internal_repeat_6	2108	2132	8.04e-5	PROSPERO
low complexity region	2133	2152	N/A	INTRINSIC
internal_repeat_2	2158	2209	2.78e-6	PROSPERO
internal_repeat_1	2228	2253	1.42e-6	PROSPERO
internal_repeat_2	2230	2286	2.78e-6	PROSPERO
low complexity region	2313	2325	N/A	INTRINSIC
low complexity region	2337	2351	N/A	INTRINSIC
low complexity region	2366	2388	N/A	INTRINSIC
low complexity region	2420	2431	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141827

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147769

Meta Mutation Damage Score

0.0604

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.2%
20x: 95.5%

Validation Efficiency

95% (76/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled-coil protein that forms intranuclear filaments attached to the inner surface of nuclear pore complexes (NPCs). The protein directly interacts with several components of the NPC. It is required for the nuclear export of mRNAs and some proteins. Oncogenic fusions of the 5' end of this gene with several different kinase genes occur in some neoplasias. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(28) : Targeted, other(2) Gene trapped(26)

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	A	G	4: 53,086,039	F488S	probably damaging	Het
Acap3	C	T	4: 155,899,424	R116W	probably damaging	Het
Adamts10	C	A	17: 33,545,390	P663T	possibly damaging	Het
Akap12	G	A	10: 4,353,333	G48S	probably damaging	Het
Ankrd7	T	A	6: 18,870,031	M261K	probably benign	Het
Ankzf1	C	A	1: 75,198,304	D599E	possibly damaging	Het
Aox1	T	C	1: 58,105,014	I1278T	possibly damaging	Het
Apcdd1	T	C	18: 62,950,079	Y327H	probably benign	Het
Asxl3	T	A	18: 22,411,496		probably benign	Het
Birc6	C	A	17: 74,662,832		probably benign	Het
Btaf1	T	A	19: 37,009,648	L1714*	probably null	Het
Cacng6	T	A	7: 3,425,004		probably benign	Het
Cdc20b	A	G	13: 113,078,612	D238G	probably damaging	Het
Celf5	T	A	10: 81,470,698	R113W	probably null	Het
Cfap70	C	A	14: 20,412,347	E659D	probably damaging	Het
Clspn	T	A	4: 126,590,598	M1183K	possibly damaging	Het
Dpy19l1	G	A	9: 24,453,891	R275C	probably damaging	Het
Dst	C	T	1: 34,186,935	S1721L	probably benign	Het
Faap100	T	C	11: 120,374,365	T562A	probably damaging	Het
Fam168b	T	C	1: 34,819,688	M133V	probably damaging	Het
Farp2	T	C	1: 93,569,087	I172T	probably damaging	Het
Fer	T	G	17: 63,896,278	S68A	probably damaging	Het
Fmo5	A	G	3: 97,645,681	E315G	probably damaging	Het
Gpr89	A	T	3: 96,871,480	F426I	probably damaging	Het
Hinfp	T	C	9: 44,296,327	I461V	possibly damaging	Het
Hsd11b1	A	T	1: 193,240,248	V167D	probably damaging	Het
Htt	A	G	5: 34,896,908	K2574E	probably benign	Het
I830077J02Rik	A	G	3: 105,926,505	S112P	probably benign	Het
Igf2bp3	T	A	6: 49,105,617	M344L	probably benign	Het
Itch	A	T	2: 155,202,257	Q494L	probably benign	Het
Itga9	T	C	9: 118,769,253		probably benign	Het
Jaml	T	A	9: 45,093,767	D152E	probably benign	Het
Kif22	A	C	7: 127,042,400	M1R	probably null	Het
Kifap3	T	C	1: 163,883,386	Y663H	probably benign	Het
Letm2	T	A	8: 25,578,770	N472I	probably damaging	Het
Mthfr	T	G	4: 148,052,224	V446G	probably damaging	Het
Myh11	T	C	16: 14,211,260	E1206G	possibly damaging	Het
Myo6	G	A	9: 80,288,056	V903I	probably damaging	Het
Myo9b	C	T	8: 71,355,225		probably benign	Het
Nr2f2	G	C	7: 70,360,175	P52R	probably damaging	Het
Nsd3	A	G	8: 25,683,257	N859S	probably benign	Het
Nucb2	C	A	7: 116,536,010	A384E	probably damaging	Het
Ogdhl	C	A	14: 32,342,037		probably null	Het
Olfr119	C	A	17: 37,701,058	C129*	probably null	Het
Olfr1247	G	A	2: 89,609,863	L80F	probably damaging	Het
Olfr1357	T	C	10: 78,611,871	T257A	probably benign	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr381	A	T	11: 73,486,575	L83Q	probably benign	Het
Parp10	C	T	15: 76,242,633	S145N	probably benign	Het
Pigh	A	G	12: 79,083,709		probably benign	Het
Pigo	A	G	4: 43,023,824		probably benign	Het
Pkp4	T	A	2: 59,305,488	V199D	possibly damaging	Het
Polr1e	C	A	4: 45,025,143		probably null	Het
Ppfia3	C	A	7: 45,348,534	R723L	probably damaging	Het
Prex1	C	A	2: 166,585,898	A945S	possibly damaging	Het
Prrt3	A	T	6: 113,495,840	V457E	probably damaging	Het
Rab39	A	G	9: 53,705,971	F49L	possibly damaging	Het
Rrs1	C	A	1: 9,545,762		probably null	Het
Rrs1	G	A	1: 9,545,767	E82K	probably damaging	Het
Serpinb3c	T	C	1: 107,276,992	D8G	probably benign	Het
Slc17a6	A	G	7: 51,646,180		probably benign	Het
Slc24a4	T	A	12: 102,228,951		probably null	Het
Smc1b	C	T	15: 85,123,759	M272I	probably benign	Het
Smc6	T	C	12: 11,283,178		probably benign	Het
Tcf20	T	C	15: 82,855,085	T722A	probably benign	Het
Tesmin	A	T	19: 3,404,088	M141L	probably benign	Het
Tmprss5	T	A	9: 49,113,160	H274Q	possibly damaging	Het
Tns1	C	T	1: 73,937,318		probably null	Het
Trank1	C	T	9: 111,366,253	T1115I	probably damaging	Het
Trmt44	A	T	5: 35,572,917	I203K	possibly damaging	Het
Ulk2	A	T	11: 61,777,785	V1037E	probably benign	Het
Usp43	A	G	11: 67,876,499	Y682H	probably damaging	Het
Vipr2	A	T	12: 116,142,882	Q366L	probably damaging	Het
Vmn1r185	C	A	7: 26,611,589	V164L	possibly damaging	Het
Vmn2r120	C	T	17: 57,525,052	V246I	probably benign	Het
Wdr66	T	C	5: 123,283,447	V182A	probably damaging	Het
Wiz	C	T	17: 32,357,033	G790R	probably damaging	Het
Wnk1	A	T	6: 119,952,733	S1016R	probably damaging	Het
Zc3hav1	A	G	6: 38,311,174	L909S	probably benign	Het
Zfp236	T	A	18: 82,640,227	I637F	probably damaging	Het
Zfp788	G	A	7: 41,649,596	G532D	probably damaging	Het
Zranb1	T	C	7: 132,950,385	I255T	probably damaging	Het

Other mutations in Tpr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00327:Tpr	APN	1	150423696	splice site	probably benign
IGL00424:Tpr	APN	1	150398595	splice site	probably benign
IGL01095:Tpr	APN	1	150410140	missense	possibly damaging	0.95
IGL01347:Tpr	APN	1	150426987	missense	probably damaging	1.00
IGL01519:Tpr	APN	1	150431168	missense	probably benign	0.01
IGL01768:Tpr	APN	1	150444448	missense	possibly damaging	0.85
IGL01939:Tpr	APN	1	150413745	missense	possibly damaging	0.82
IGL01988:Tpr	APN	1	150426999	splice site	probably null
IGL02065:Tpr	APN	1	150413774	missense	probably benign	0.13
IGL02110:Tpr	APN	1	150435742	missense	probably damaging	0.97
IGL02311:Tpr	APN	1	150398653	missense	probably damaging	0.97
IGL02454:Tpr	APN	1	150431192	missense	probably benign	0.00
IGL02569:Tpr	APN	1	150425631	unclassified	probably benign
IGL03168:Tpr	APN	1	150408757	missense	probably benign	0.04
IGL03193:Tpr	APN	1	150440080	missense	possibly damaging	0.85
IGL03333:Tpr	APN	1	150426967	missense	probably benign	0.04
gridiron	UTSW	1	150423516	missense	probably damaging	1.00
Pouch	UTSW	1	150433772	missense	probably damaging	1.00
punt	UTSW	1	150418039	missense	probably benign	0.02
Turf	UTSW	1	150442245	critical splice donor site	probably null
F6893:Tpr	UTSW	1	150393562	missense	possibly damaging	0.84
PIT4305001:Tpr	UTSW	1	150440137	missense	possibly damaging	0.85
PIT4469001:Tpr	UTSW	1	150403956	missense	probably benign	0.41
R0085:Tpr	UTSW	1	150417413	missense	possibly damaging	0.95
R0101:Tpr	UTSW	1	150409302	splice site	probably benign
R0116:Tpr	UTSW	1	150410147	missense	probably damaging	0.98
R0136:Tpr	UTSW	1	150430595	missense	probably benign	0.01
R0219:Tpr	UTSW	1	150443258	splice site	probably null
R0380:Tpr	UTSW	1	150412947	missense	probably benign	0.27
R0403:Tpr	UTSW	1	150407414	splice site	probably benign
R0469:Tpr	UTSW	1	150423667	frame shift	probably null
R0480:Tpr	UTSW	1	150428241	missense	possibly damaging	0.83
R0514:Tpr	UTSW	1	150402273	missense	possibly damaging	0.55
R0563:Tpr	UTSW	1	150408858	missense	probably benign	0.13
R0631:Tpr	UTSW	1	150422531	missense	probably damaging	0.98
R0685:Tpr	UTSW	1	150433725	missense	possibly damaging	0.69
R0730:Tpr	UTSW	1	150393407	utr 5 prime	probably benign
R0739:Tpr	UTSW	1	150407497	missense	possibly damaging	0.94
R0780:Tpr	UTSW	1	150431341	missense	probably benign	0.00
R1018:Tpr	UTSW	1	150442183	missense	possibly damaging	0.53
R1084:Tpr	UTSW	1	150442161	missense	probably benign	0.18
R1532:Tpr	UTSW	1	150418000	missense	probably damaging	0.99
R1551:Tpr	UTSW	1	150436801	missense	probably benign	0.00
R1608:Tpr	UTSW	1	150426893	missense	probably damaging	0.96
R1759:Tpr	UTSW	1	150429524	missense	probably benign	0.19
R1817:Tpr	UTSW	1	150419903	missense	probably damaging	0.98
R1932:Tpr	UTSW	1	150421663	missense	probably benign	0.00
R1978:Tpr	UTSW	1	150419907	missense	possibly damaging	0.65
R2031:Tpr	UTSW	1	150442119	missense	probably benign
R2176:Tpr	UTSW	1	150419940	missense	possibly damaging	0.56
R2235:Tpr	UTSW	1	150442092	missense	probably benign	0.33
R2339:Tpr	UTSW	1	150413774	missense	probably benign	0.01
R2367:Tpr	UTSW	1	150433728	missense	probably damaging	0.99
R2507:Tpr	UTSW	1	150392944	start codon destroyed	probably null
R3931:Tpr	UTSW	1	150435904	missense	probably damaging	1.00
R4320:Tpr	UTSW	1	150423574	missense	possibly damaging	0.96
R4439:Tpr	UTSW	1	150403961	missense	probably benign	0.01
R4568:Tpr	UTSW	1	150392959	unclassified	probably benign
R4644:Tpr	UTSW	1	150423499	missense	probably benign	0.01
R4665:Tpr	UTSW	1	150444399	missense	probably damaging	0.97
R4672:Tpr	UTSW	1	150423567	missense	probably benign	0.45
R4673:Tpr	UTSW	1	150423567	missense	probably benign	0.45
R4735:Tpr	UTSW	1	150442196	missense	possibly damaging	0.91
R4767:Tpr	UTSW	1	150430529	intron	probably benign
R4772:Tpr	UTSW	1	150413113	missense	possibly damaging	0.46
R4815:Tpr	UTSW	1	150398608	missense	probably benign	0.01
R4839:Tpr	UTSW	1	150449197	nonsense	probably null
R4844:Tpr	UTSW	1	150445879	missense	possibly damaging	0.86
R4925:Tpr	UTSW	1	150432565	missense	probably benign	0.00
R4967:Tpr	UTSW	1	150410059	missense	probably damaging	0.99
R5017:Tpr	UTSW	1	150398637	missense	probably benign	0.00
R5096:Tpr	UTSW	1	150446202	missense	probably damaging	0.99
R5353:Tpr	UTSW	1	150445924	missense	probably damaging	1.00
R5354:Tpr	UTSW	1	150445924	missense	probably damaging	1.00
R5484:Tpr	UTSW	1	150426888	missense	probably benign	0.33
R5601:Tpr	UTSW	1	150435853	missense	possibly damaging	0.75
R5642:Tpr	UTSW	1	150423818	missense	probably damaging	0.99
R5779:Tpr	UTSW	1	150423541	missense	probably damaging	1.00
R5787:Tpr	UTSW	1	150395286	missense	probably benign	0.01
R5892:Tpr	UTSW	1	150407400	missense	probably benign	0.44
R5915:Tpr	UTSW	1	150425649	missense	probably benign	0.15
R5928:Tpr	UTSW	1	150428127	missense	probably benign	0.30
R6146:Tpr	UTSW	1	150423162	missense	possibly damaging	0.83
R6154:Tpr	UTSW	1	150423816	missense	probably benign	0.00
R6234:Tpr	UTSW	1	150418039	missense	probably benign	0.02
R6263:Tpr	UTSW	1	150442245	critical splice donor site	probably null
R6318:Tpr	UTSW	1	150445888	missense	possibly damaging	0.93
R6550:Tpr	UTSW	1	150423977	missense	probably damaging	1.00
R6592:Tpr	UTSW	1	150411905	missense	possibly damaging	0.83
R6704:Tpr	UTSW	1	150406508	missense	possibly damaging	0.80
R6716:Tpr	UTSW	1	150414765	missense	probably damaging	1.00
R6836:Tpr	UTSW	1	150436673	splice site	probably null
R6886:Tpr	UTSW	1	150423965	missense	probably benign	0.00
R6894:Tpr	UTSW	1	150436847	missense	probably benign	0.28
R6928:Tpr	UTSW	1	150408785	missense	possibly damaging	0.83
R7011:Tpr	UTSW	1	150433772	missense	probably damaging	1.00
R7034:Tpr	UTSW	1	150423607	missense	probably benign	0.02
R7036:Tpr	UTSW	1	150423607	missense	probably benign	0.02
R7183:Tpr	UTSW	1	150406551	missense	probably damaging	1.00
R7221:Tpr	UTSW	1	150446178	missense	possibly damaging	0.96
R7223:Tpr	UTSW	1	150439256	missense	possibly damaging	0.53
R7294:Tpr	UTSW	1	150403887	missense	probably damaging	1.00
R7343:Tpr	UTSW	1	150393494	missense	unknown
R7361:Tpr	UTSW	1	150447621	missense	possibly damaging	0.73
R7405:Tpr	UTSW	1	150442127	missense	probably benign	0.02
R7637:Tpr	UTSW	1	150423516	missense	probably damaging	1.00
R7720:Tpr	UTSW	1	150429532	missense	possibly damaging	0.49
R7721:Tpr	UTSW	1	150444429	missense	probably benign
R7751:Tpr	UTSW	1	150419895	missense	probably benign	0.17
R7804:Tpr	UTSW	1	150432559	missense	probably damaging	0.99
R7878:Tpr	UTSW	1	150423660	missense	possibly damaging	0.67
R7973:Tpr	UTSW	1	150403887	missense	probably damaging	1.00
R8013:Tpr	UTSW	1	150398608	missense	probably benign
R8220:Tpr	UTSW	1	150432413	missense	probably benign	0.05
R8274:Tpr	UTSW	1	150423479	splice site	probably benign
R8428:Tpr	UTSW	1	150414813	missense	probably damaging	1.00
R8482:Tpr	UTSW	1	150433700	missense	probably damaging	1.00
R8699:Tpr	UTSW	1	150418021	missense	probably damaging	0.99
R8859:Tpr	UTSW	1	150408846	missense	possibly damaging	0.90
R9119:Tpr	UTSW	1	150404002	missense	probably damaging	0.99
R9326:Tpr	UTSW	1	150425656	missense	possibly damaging	0.86
R9618:Tpr	UTSW	1	150446228	missense	possibly damaging	0.70
R9680:Tpr	UTSW	1	150439136	missense	probably benign	0.32
R9776:Tpr	UTSW	1	150449188	missense	probably benign	0.00
X0021:Tpr	UTSW	1	150395207	missense	probably damaging	1.00
Z1177:Tpr	UTSW	1	150428235	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- agctctttctccagcttcCATTATATTGTTTT -3'
(R):5'- GTCTCAGATCGCTCTAGTATGCCCTAA -3'

Sequencing Primer
(F):5'- GAACAGTTTGCTAGAGCTAAATTAAC -3'
(R):5'- aatatttaGTGGTATGGAATGGGGGC -3'

Posted On

2013-05-09