Incidental Mutation 'R4544:Olfr446'
ID333672
Institutional Source Beutler Lab
Gene Symbol Olfr446
Ensembl Gene ENSMUSG00000073111
Gene Nameolfactory receptor 446
SynonymsGA_x6K02T2P3E9-4632269-4631343, MOR261-12
MMRRC Submission 041779-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R4544 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location42921377-42931141 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 42927414 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 61 (S61L)
Ref Sequence ENSEMBL: ENSMUSP00000150255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101461] [ENSMUST00000215369] [ENSMUST00000215686] [ENSMUST00000216199]
Predicted Effect probably damaging
Transcript: ENSMUST00000101461
AA Change: S61L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099005
Gene: ENSMUSG00000073111
AA Change: S61L

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 1.7e-62 PFAM
Pfam:7TM_GPCR_Srsx 32 282 1.7e-5 PFAM
Pfam:7tm_1 38 287 3.2e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215369
AA Change: S61L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000215686
AA Change: S61L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000216199
AA Change: S61L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.4304 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Alg9 C T 9: 50,805,354 T409M possibly damaging Het
Atf7 A G 15: 102,534,327 V449A probably benign Het
C1s1 A G 6: 124,531,540 S497P probably benign Het
Ccnyl1 G T 1: 64,723,576 M347I probably benign Het
Chil4 C A 3: 106,210,606 R116L probably damaging Het
Cmpk2 A G 12: 26,478,017 E411G probably damaging Het
Cmya5 G A 13: 93,091,918 R2221* probably null Het
Csmd1 A T 8: 16,710,636 F161Y possibly damaging Het
Cspg4 T A 9: 56,888,629 L1216Q possibly damaging Het
Dppa3 A G 6: 122,626,767 probably benign Het
Ednra A G 8: 77,674,911 probably null Het
Fancd2 A G 6: 113,572,642 probably null Het
Fastkd1 C T 2: 69,712,311 E51K probably damaging Het
Fndc1 T A 17: 7,773,544 D440V unknown Het
Gm10093 A T 17: 78,492,959 T460S probably benign Het
Gm11808 C T 4: 3,973,244 R106H probably benign Het
Gm9934 A G 7: 93,052,980 noncoding transcript Het
Ifi205 T C 1: 174,026,573 I171M possibly damaging Het
Ifi213 T C 1: 173,582,127 probably null Het
Insig2 A T 1: 121,312,192 probably benign Het
Kdm7a T C 6: 39,175,472 R97G probably benign Het
Krt23 G A 11: 99,478,276 T397M probably benign Het
Lepr G A 4: 101,768,228 V527I possibly damaging Het
Lmo2 C T 2: 103,976,037 P25L probably damaging Het
Lsr C T 7: 30,971,976 V111M probably damaging Het
Mest T C 6: 30,740,680 W13R probably damaging Het
Mfn2 A G 4: 147,887,452 V224A probably benign Het
Mkx T C 18: 7,000,651 Y97C probably damaging Het
Mndal A T 1: 173,875,664 Y58* probably null Het
Myo9b T C 8: 71,327,941 V494A probably damaging Het
Nek1 C T 8: 61,016,304 Q132* probably null Het
Olfr774 A C 10: 129,238,158 N3T probably damaging Het
Osbpl6 T C 2: 76,584,492 V409A possibly damaging Het
Pde8a A T 7: 81,328,099 R713S probably damaging Het
Pex10 T C 4: 155,070,495 Y235H probably benign Het
Pik3cb T A 9: 99,039,759 K1050I probably damaging Het
Prss56 A G 1: 87,184,642 D85G probably damaging Het
Psg26 T C 7: 18,478,539 N297S probably damaging Het
Rdh16f1 T C 10: 127,790,837 L253S probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc7a8 C G 14: 54,735,790 G240A possibly damaging Het
Slc8b1 G A 5: 120,531,153 probably null Het
Sorbs1 G A 19: 40,311,850 T575M probably damaging Het
Syne3 T A 12: 104,959,469 K313M probably damaging Het
Tas2r108 A G 6: 40,493,808 T73A probably benign Het
Ttn T C 2: 76,822,588 probably null Het
Ubr3 G A 2: 69,956,093 M850I probably benign Het
Vmn2r78 A T 7: 86,921,191 M306L probably benign Het
Vmn2r9 T G 5: 108,847,685 M366L probably benign Het
Zan C G 5: 137,383,834 M5150I unknown Het
Other mutations in Olfr446
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02947:Olfr446 APN 6 42927896 missense probably benign 0.24
IGL03164:Olfr446 APN 6 42928130 nonsense probably null
PIT4519001:Olfr446 UTSW 6 42927644 missense probably damaging 1.00
R1760:Olfr446 UTSW 6 42927497 missense possibly damaging 0.90
R1883:Olfr446 UTSW 6 42927830 missense probably damaging 0.99
R1884:Olfr446 UTSW 6 42927830 missense probably damaging 0.99
R2180:Olfr446 UTSW 6 42927525 missense probably benign 0.14
R3001:Olfr446 UTSW 6 42927954 missense probably damaging 1.00
R3002:Olfr446 UTSW 6 42927954 missense probably damaging 1.00
R4435:Olfr446 UTSW 6 42928089 missense probably damaging 1.00
R4546:Olfr446 UTSW 6 42927414 missense probably damaging 1.00
R5009:Olfr446 UTSW 6 42927433 missense probably damaging 1.00
R5236:Olfr446 UTSW 6 42927781 missense probably benign 0.04
R5290:Olfr446 UTSW 6 42928038 missense probably damaging 0.98
R5297:Olfr446 UTSW 6 42927437 missense probably benign 0.17
R7371:Olfr446 UTSW 6 42927535 nonsense probably null
X0065:Olfr446 UTSW 6 42928056 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACATGGATCACTGAGGTCATTC -3'
(R):5'- CTCTCCAGCTCATGATCAGTGTG -3'

Sequencing Primer
(F):5'- CATGGATCACTGAGGTCATTCTACTG -3'
(R):5'- CAGCTCATGATCAGTGTGTATTTC -3'
Posted On2015-08-18