Mutagenetix > Incidental Mutation

Incidental Mutation 'R4544:Fancd2'

333673

Institutional Source

Beutler Lab

Gene Symbol

Fancd2

Ensembl Gene

ENSMUSG00000034023

Gene Name

Fanconi anemia, complementation group D2

Synonyms

2410150O07Rik

MMRRC Submission

041779-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4544 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

113531682-113597017 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to G at 113572642 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000144928 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036340] [ENSMUST00000129462] [ENSMUST00000204827]

AlphaFold

Q80V62

Predicted Effect

probably null
Transcript: ENSMUST00000036340

SMART Domains

Protein: ENSMUSP00000045667
Gene: ENSMUSG00000034023

Domain	Start	End	E-Value	Type
Pfam:FancD2	1	1415	N/A	PFAM
low complexity region	1430	1450	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129462

SMART Domains

Protein: ENSMUSP00000145220
Gene: ENSMUSG00000034023

Domain	Start	End	E-Value	Type
Pfam:FancD2	1	80	4.9e-26	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000204827

SMART Domains

Protein: ENSMUSP00000144928
Gene: ENSMUSG00000034023

Domain	Start	End	E-Value	Type
Pfam:FancD2	1	1402	N/A	PFAM
low complexity region	1417	1437	N/A	INTRINSIC

Meta Mutation Damage Score

0.9497

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group D2. This protein is monoubiquinated in response to DNA damage, resulting in its localization to nuclear foci with other proteins (BRCA1 AND BRCA2) involved in homology-directed DNA repair. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutant mice exhibit defects observed in human patients with Fanconi anemia (FA) meiotic defects and germ cell loss. In addition, mutant mice display perinatal lethality, susceptiblity ot epithelial cancer, and microphthalmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akr1c20	A	C	13: 4,507,844	V201G	probably damaging	Het
Alg9	C	T	9: 50,805,354	T409M	possibly damaging	Het
Atf7	A	G	15: 102,534,327	V449A	probably benign	Het
C1s1	A	G	6: 124,531,540	S497P	probably benign	Het
Ccnyl1	G	T	1: 64,723,576	M347I	probably benign	Het
Chil4	C	A	3: 106,210,606	R116L	probably damaging	Het
Cmpk2	A	G	12: 26,478,017	E411G	probably damaging	Het
Cmya5	G	A	13: 93,091,918	R2221*	probably null	Het
Csmd1	A	T	8: 16,710,636	F161Y	possibly damaging	Het
Cspg4	T	A	9: 56,888,629	L1216Q	possibly damaging	Het
Dppa3	A	G	6: 122,626,767		probably benign	Het
Ednra	A	G	8: 77,674,911		probably null	Het
Fastkd1	C	T	2: 69,712,311	E51K	probably damaging	Het
Fndc1	T	A	17: 7,773,544	D440V	unknown	Het
Gm10093	A	T	17: 78,492,959	T460S	probably benign	Het
Gm11808	C	T	4: 3,973,244	R106H	probably benign	Het
Gm9934	A	G	7: 93,052,980		noncoding transcript	Het
Ifi205	T	C	1: 174,026,573	I171M	possibly damaging	Het
Ifi213	T	C	1: 173,582,127		probably null	Het
Insig2	A	T	1: 121,312,192		probably benign	Het
Kdm7a	T	C	6: 39,175,472	R97G	probably benign	Het
Krt23	G	A	11: 99,478,276	T397M	probably benign	Het
Lepr	G	A	4: 101,768,228	V527I	possibly damaging	Het
Lmo2	C	T	2: 103,976,037	P25L	probably damaging	Het
Lsr	C	T	7: 30,971,976	V111M	probably damaging	Het
Mest	T	C	6: 30,740,680	W13R	probably damaging	Het
Mfn2	A	G	4: 147,887,452	V224A	probably benign	Het
Mkx	T	C	18: 7,000,651	Y97C	probably damaging	Het
Mndal	A	T	1: 173,875,664	Y58*	probably null	Het
Myo9b	T	C	8: 71,327,941	V494A	probably damaging	Het
Nek1	C	T	8: 61,016,304	Q132*	probably null	Het
Olfr446	C	T	6: 42,927,414	S61L	probably damaging	Het
Olfr774	A	C	10: 129,238,158	N3T	probably damaging	Het
Osbpl6	T	C	2: 76,584,492	V409A	possibly damaging	Het
Pde8a	A	T	7: 81,328,099	R713S	probably damaging	Het
Pex10	T	C	4: 155,070,495	Y235H	probably benign	Het
Pik3cb	T	A	9: 99,039,759	K1050I	probably damaging	Het
Prss56	A	G	1: 87,184,642	D85G	probably damaging	Het
Psg26	T	C	7: 18,478,539	N297S	probably damaging	Het
Rdh16f1	T	C	10: 127,790,837	L253S	probably benign	Het
Slc15a4	A	G	5: 127,604,536		probably null	Het
Slc7a8	C	G	14: 54,735,790	G240A	possibly damaging	Het
Slc8b1	G	A	5: 120,531,153		probably null	Het
Sorbs1	G	A	19: 40,311,850	T575M	probably damaging	Het
Syne3	T	A	12: 104,959,469	K313M	probably damaging	Het
Tas2r108	A	G	6: 40,493,808	T73A	probably benign	Het
Ttn	T	C	2: 76,822,588		probably null	Het
Ubr3	G	A	2: 69,956,093	M850I	probably benign	Het
Vmn2r78	A	T	7: 86,921,191	M306L	probably benign	Het
Vmn2r9	T	G	5: 108,847,685	M366L	probably benign	Het
Zan	C	G	5: 137,383,834	M5150I	unknown	Het

Other mutations in Fancd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00401:Fancd2	APN	6	113564396	critical splice donor site	probably null
IGL00475:Fancd2	APN	6	113568610	missense	probably benign	0.01
IGL01319:Fancd2	APN	6	113584899	missense	probably damaging	0.98
IGL01339:Fancd2	APN	6	113553752	missense	probably benign	0.00
IGL01373:Fancd2	APN	6	113553752	missense	probably benign	0.00
IGL01393:Fancd2	APN	6	113577360	splice site	probably benign
IGL01630:Fancd2	APN	6	113563124	missense	probably damaging	1.00
IGL01769:Fancd2	APN	6	113545111	missense	possibly damaging	0.90
IGL01882:Fancd2	APN	6	113546640	missense	probably benign	0.05
IGL02029:Fancd2	APN	6	113570975	missense	probably benign	0.44
IGL02224:Fancd2	APN	6	113568320	critical splice donor site	probably null
IGL02271:Fancd2	APN	6	113535759	splice site	probably benign
IGL02352:Fancd2	APN	6	113563112	missense	probably damaging	1.00
IGL02359:Fancd2	APN	6	113563112	missense	probably damaging	1.00
IGL02427:Fancd2	APN	6	113549352	splice site	probably null
IGL02512:Fancd2	APN	6	113570943	missense	probably damaging	1.00
IGL02530:Fancd2	APN	6	113562461	missense	probably damaging	1.00
IGL02801:Fancd2	APN	6	113593317	missense	probably benign	0.00
IGL03090:Fancd2	APN	6	113537597	splice site	probably null
IGL03247:Fancd2	APN	6	113568208	missense	probably benign	0.03
R0278:Fancd2	UTSW	6	113548448	critical splice donor site	probably null
R0401:Fancd2	UTSW	6	113548343	missense	possibly damaging	0.46
R0420:Fancd2	UTSW	6	113536979	missense	probably damaging	0.98
R0496:Fancd2	UTSW	6	113555130	splice site	probably benign
R0762:Fancd2	UTSW	6	113574658	missense	probably benign	0.20
R0827:Fancd2	UTSW	6	113586249	critical splice donor site	probably null
R1225:Fancd2	UTSW	6	113535861	missense	probably damaging	0.99
R1576:Fancd2	UTSW	6	113578405	missense	probably damaging	0.98
R2010:Fancd2	UTSW	6	113593291	missense	probably damaging	0.96
R2079:Fancd2	UTSW	6	113555187	missense	probably damaging	1.00
R2118:Fancd2	UTSW	6	113560074	splice site	probably benign
R2141:Fancd2	UTSW	6	113549321	missense	probably benign	0.00
R2168:Fancd2	UTSW	6	113591159	missense	possibly damaging	0.92
R2180:Fancd2	UTSW	6	113574637	missense	probably benign	0.33
R3016:Fancd2	UTSW	6	113536726	missense	probably benign	0.00
R3153:Fancd2	UTSW	6	113593269	missense	possibly damaging	0.55
R3154:Fancd2	UTSW	6	113593269	missense	possibly damaging	0.55
R3783:Fancd2	UTSW	6	113565204	missense	probably damaging	1.00
R3786:Fancd2	UTSW	6	113565204	missense	probably damaging	1.00
R3787:Fancd2	UTSW	6	113565204	missense	probably damaging	1.00
R4379:Fancd2	UTSW	6	113561716	missense	probably benign	0.00
R4388:Fancd2	UTSW	6	113556368	missense	probably damaging	0.99
R4598:Fancd2	UTSW	6	113585477	missense	probably benign	0.06
R4832:Fancd2	UTSW	6	113553722	missense	probably benign	0.16
R4841:Fancd2	UTSW	6	113562430	missense	probably damaging	1.00
R4922:Fancd2	UTSW	6	113585473	missense	probably benign	0.03
R5375:Fancd2	UTSW	6	113568712	missense	possibly damaging	0.93
R5579:Fancd2	UTSW	6	113560051	critical splice acceptor site	probably null
R5782:Fancd2	UTSW	6	113548872	missense	probably benign	0.00
R5871:Fancd2	UTSW	6	113556282	missense	probably benign	0.30
R5901:Fancd2	UTSW	6	113549365	missense	probably damaging	1.00
R5909:Fancd2	UTSW	6	113561711	missense	probably benign
R6026:Fancd2	UTSW	6	113551770	missense	possibly damaging	0.46
R6166:Fancd2	UTSW	6	113555251	missense	possibly damaging	0.67
R6393:Fancd2	UTSW	6	113578413	missense	probably benign	0.01
R6666:Fancd2	UTSW	6	113585509	missense	probably damaging	0.96
R6669:Fancd2	UTSW	6	113593327	missense	probably benign	0.00
R6676:Fancd2	UTSW	6	113537665	nonsense	probably null
R6762:Fancd2	UTSW	6	113586016	splice site	probably null
R6911:Fancd2	UTSW	6	113548385	missense	probably damaging	0.98
R6992:Fancd2	UTSW	6	113571018	critical splice donor site	probably null
R7091:Fancd2	UTSW	6	113545101	missense	probably damaging	1.00
R7252:Fancd2	UTSW	6	113556285	missense	probably damaging	0.98
R7343:Fancd2	UTSW	6	113536939	missense	probably benign	0.01
R7344:Fancd2	UTSW	6	113568709	missense	probably benign	0.09
R7354:Fancd2	UTSW	6	113595946	missense	unknown
R7489:Fancd2	UTSW	6	113564304	missense	probably benign
R7501:Fancd2	UTSW	6	113548403	missense	possibly damaging	0.95
R7504:Fancd2	UTSW	6	113545038	missense	probably damaging	1.00
R7992:Fancd2	UTSW	6	113565204	missense	probably damaging	1.00
R8027:Fancd2	UTSW	6	113546622	missense	probably damaging	1.00
R8487:Fancd2	UTSW	6	113568226	missense	probably damaging	1.00
R8509:Fancd2	UTSW	6	113572570	missense	probably benign	0.00
R8757:Fancd2	UTSW	6	113560093	missense	possibly damaging	0.91
R8960:Fancd2	UTSW	6	113563168	critical splice donor site	probably null
R8978:Fancd2	UTSW	6	113585546	splice site	probably benign
R9110:Fancd2	UTSW	6	113535801	missense	possibly damaging	0.94
R9116:Fancd2	UTSW	6	113555219	missense	probably benign	0.00
R9490:Fancd2	UTSW	6	113578455	missense	probably damaging	0.98
R9667:Fancd2	UTSW	6	113553756	nonsense	probably null
Z1088:Fancd2	UTSW	6	113581422	missense	probably benign	0.00
Z1177:Fancd2	UTSW	6	113545025	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGGCAAGTGCTTTGTCCAC -3'
(R):5'- AGGAATGCCACTGTGTTACCTAG -3'

Sequencing Primer
(F):5'- GGCAAGTGCTTTGTCCACTGAAC -3'
(R):5'- TGCCACTGTGTTACCTAGTAAATC -3'

Posted On

2015-08-18