Incidental Mutation 'R4544:Vmn2r78'
ID 333679
Institutional Source Beutler Lab
Gene Symbol Vmn2r78
Ensembl Gene ENSMUSG00000091962
Gene Name vomeronasal 2, receptor 78
Synonyms
MMRRC Submission 041779-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.071) question?
Stock # R4544 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 86564557-86604385 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 86570399 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 306 (M306L)
Ref Sequence ENSEMBL: ENSMUSP00000126698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170835]
AlphaFold K7N6U5
Predicted Effect probably benign
Transcript: ENSMUST00000170835
AA Change: M306L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126698
Gene: ENSMUSG00000091962
AA Change: M306L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 75 464 5.9e-31 PFAM
Pfam:NCD3G 507 559 8.1e-21 PFAM
Pfam:7tm_3 592 827 1e-52 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 A C 13: 4,557,843 (GRCm39) V201G probably damaging Het
Alg9 C T 9: 50,716,654 (GRCm39) T409M possibly damaging Het
Atf7 A G 15: 102,442,762 (GRCm39) V449A probably benign Het
C1s1 A G 6: 124,508,499 (GRCm39) S497P probably benign Het
Ccnyl1 G T 1: 64,762,735 (GRCm39) M347I probably benign Het
Chil4 C A 3: 106,117,922 (GRCm39) R116L probably damaging Het
Cmpk2 A G 12: 26,528,016 (GRCm39) E411G probably damaging Het
Cmya5 G A 13: 93,228,426 (GRCm39) R2221* probably null Het
Csmd1 A T 8: 16,760,652 (GRCm39) F161Y possibly damaging Het
Cspg4 T A 9: 56,795,913 (GRCm39) L1216Q possibly damaging Het
Dppa3 A G 6: 122,603,726 (GRCm39) probably benign Het
Ednra A G 8: 78,401,540 (GRCm39) probably null Het
Fancd2 A G 6: 113,549,603 (GRCm39) probably null Het
Fastkd1 C T 2: 69,542,655 (GRCm39) E51K probably damaging Het
Fndc1 T A 17: 7,992,376 (GRCm39) D440V unknown Het
Gm9934 A G 7: 92,702,188 (GRCm39) noncoding transcript Het
Hdac1-ps A T 17: 78,800,388 (GRCm39) T460S probably benign Het
Ifi205 T C 1: 173,854,139 (GRCm39) I171M possibly damaging Het
Ifi213 T C 1: 173,409,693 (GRCm39) probably null Het
Insig2 A T 1: 121,239,921 (GRCm39) probably benign Het
Kdm7a T C 6: 39,152,406 (GRCm39) R97G probably benign Het
Krt23 G A 11: 99,369,102 (GRCm39) T397M probably benign Het
Lepr G A 4: 101,625,425 (GRCm39) V527I possibly damaging Het
Lmo2 C T 2: 103,806,382 (GRCm39) P25L probably damaging Het
Lsr C T 7: 30,671,401 (GRCm39) V111M probably damaging Het
Mest T C 6: 30,740,679 (GRCm39) W13R probably damaging Het
Mfn2 A G 4: 147,971,909 (GRCm39) V224A probably benign Het
Mkx T C 18: 7,000,651 (GRCm39) Y97C probably damaging Het
Mndal A T 1: 173,703,230 (GRCm39) Y58* probably null Het
Myo9b T C 8: 71,780,585 (GRCm39) V494A probably damaging Het
Nek1 C T 8: 61,469,338 (GRCm39) Q132* probably null Het
Or2a12 C T 6: 42,904,348 (GRCm39) S61L probably damaging Het
Or6c5 A C 10: 129,074,027 (GRCm39) N3T probably damaging Het
Osbpl6 T C 2: 76,414,836 (GRCm39) V409A possibly damaging Het
Pde8a A T 7: 80,977,847 (GRCm39) R713S probably damaging Het
Pex10 T C 4: 155,154,952 (GRCm39) Y235H probably benign Het
Pik3cb T A 9: 98,921,812 (GRCm39) K1050I probably damaging Het
Prss56 A G 1: 87,112,364 (GRCm39) D85G probably damaging Het
Psg26 T C 7: 18,212,464 (GRCm39) N297S probably damaging Het
Rdh16f1 T C 10: 127,626,706 (GRCm39) L253S probably benign Het
Slc15a4 A G 5: 127,681,600 (GRCm39) probably null Het
Slc7a8 C G 14: 54,973,247 (GRCm39) G240A possibly damaging Het
Slc8b1 G A 5: 120,669,218 (GRCm39) probably null Het
Sorbs1 G A 19: 40,300,294 (GRCm39) T575M probably damaging Het
Syne3 T A 12: 104,925,728 (GRCm39) K313M probably damaging Het
Tas2r108 A G 6: 40,470,742 (GRCm39) T73A probably benign Het
Ttn T C 2: 76,652,932 (GRCm39) probably null Het
Uba52rt C T 4: 3,973,244 (GRCm39) R106H probably benign Het
Ubr3 G A 2: 69,786,437 (GRCm39) M850I probably benign Het
Vmn2r9 T G 5: 108,995,551 (GRCm39) M366L probably benign Het
Zan C G 5: 137,382,096 (GRCm39) M5150I unknown Het
Other mutations in Vmn2r78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Vmn2r78 APN 7 86,564,569 (GRCm39) missense unknown
IGL01473:Vmn2r78 APN 7 86,569,520 (GRCm39) missense possibly damaging 0.61
IGL01767:Vmn2r78 APN 7 86,603,643 (GRCm39) missense probably benign 0.28
IGL02322:Vmn2r78 APN 7 86,570,687 (GRCm39) missense probably damaging 0.96
IGL02537:Vmn2r78 APN 7 86,603,496 (GRCm39) missense probably damaging 0.99
IGL03297:Vmn2r78 APN 7 86,569,969 (GRCm39) nonsense probably null
ANU74:Vmn2r78 UTSW 7 86,570,273 (GRCm39) missense possibly damaging 0.62
R0035:Vmn2r78 UTSW 7 86,569,413 (GRCm39) missense probably benign 0.22
R0081:Vmn2r78 UTSW 7 86,572,235 (GRCm39) missense probably benign 0.35
R0401:Vmn2r78 UTSW 7 86,570,519 (GRCm39) missense probably benign 0.04
R0751:Vmn2r78 UTSW 7 86,603,588 (GRCm39) missense possibly damaging 0.77
R1341:Vmn2r78 UTSW 7 86,571,477 (GRCm39) missense possibly damaging 0.71
R1386:Vmn2r78 UTSW 7 86,564,615 (GRCm39) missense unknown
R1526:Vmn2r78 UTSW 7 86,571,465 (GRCm39) splice site probably null
R1712:Vmn2r78 UTSW 7 86,604,132 (GRCm39) missense probably damaging 1.00
R1739:Vmn2r78 UTSW 7 86,569,997 (GRCm39) missense probably benign
R1812:Vmn2r78 UTSW 7 86,569,995 (GRCm39) missense probably benign 0.38
R2011:Vmn2r78 UTSW 7 86,604,287 (GRCm39) missense possibly damaging 0.52
R2144:Vmn2r78 UTSW 7 86,603,690 (GRCm39) missense probably damaging 1.00
R2197:Vmn2r78 UTSW 7 86,570,535 (GRCm39) missense probably damaging 0.96
R2291:Vmn2r78 UTSW 7 86,569,362 (GRCm39) missense probably damaging 1.00
R2409:Vmn2r78 UTSW 7 86,569,953 (GRCm39) splice site probably benign
R3023:Vmn2r78 UTSW 7 86,604,174 (GRCm39) missense probably damaging 1.00
R4486:Vmn2r78 UTSW 7 86,569,959 (GRCm39) critical splice acceptor site probably null
R4512:Vmn2r78 UTSW 7 86,569,452 (GRCm39) missense probably benign 0.00
R4515:Vmn2r78 UTSW 7 86,603,466 (GRCm39) missense probably damaging 0.99
R4546:Vmn2r78 UTSW 7 86,603,811 (GRCm39) missense probably damaging 1.00
R4872:Vmn2r78 UTSW 7 86,603,916 (GRCm39) missense possibly damaging 0.87
R4928:Vmn2r78 UTSW 7 86,603,835 (GRCm39) missense probably damaging 1.00
R5101:Vmn2r78 UTSW 7 86,571,563 (GRCm39) missense probably damaging 1.00
R5265:Vmn2r78 UTSW 7 86,569,332 (GRCm39) missense probably damaging 1.00
R5328:Vmn2r78 UTSW 7 86,570,238 (GRCm39) missense probably damaging 0.98
R5442:Vmn2r78 UTSW 7 86,569,330 (GRCm39) missense possibly damaging 0.95
R5567:Vmn2r78 UTSW 7 86,570,737 (GRCm39) missense probably benign 0.17
R5572:Vmn2r78 UTSW 7 86,564,720 (GRCm39) missense probably benign 0.01
R5636:Vmn2r78 UTSW 7 86,603,637 (GRCm39) missense probably damaging 0.99
R5901:Vmn2r78 UTSW 7 86,603,796 (GRCm39) missense probably damaging 1.00
R5977:Vmn2r78 UTSW 7 86,604,115 (GRCm39) missense probably benign 0.00
R5977:Vmn2r78 UTSW 7 86,569,541 (GRCm39) missense possibly damaging 0.74
R6276:Vmn2r78 UTSW 7 86,570,318 (GRCm39) missense probably benign 0.00
R6386:Vmn2r78 UTSW 7 86,571,545 (GRCm39) nonsense probably null
R6724:Vmn2r78 UTSW 7 86,603,466 (GRCm39) missense probably damaging 0.99
R6852:Vmn2r78 UTSW 7 86,603,811 (GRCm39) missense probably damaging 1.00
R6896:Vmn2r78 UTSW 7 86,571,558 (GRCm39) missense probably benign 0.10
R7385:Vmn2r78 UTSW 7 86,571,633 (GRCm39) missense probably benign 0.18
R7578:Vmn2r78 UTSW 7 86,603,552 (GRCm39) nonsense probably null
R7680:Vmn2r78 UTSW 7 86,604,149 (GRCm39) missense probably damaging 1.00
R7748:Vmn2r78 UTSW 7 86,570,343 (GRCm39) missense probably benign 0.00
R7852:Vmn2r78 UTSW 7 86,569,378 (GRCm39) nonsense probably null
R8031:Vmn2r78 UTSW 7 86,604,075 (GRCm39) missense probably damaging 1.00
R8070:Vmn2r78 UTSW 7 86,571,695 (GRCm39) missense probably benign 0.01
R8085:Vmn2r78 UTSW 7 86,603,998 (GRCm39) missense probably benign 0.00
R8163:Vmn2r78 UTSW 7 86,603,660 (GRCm39) missense probably damaging 1.00
R8501:Vmn2r78 UTSW 7 86,570,094 (GRCm39) missense probably damaging 0.99
R8749:Vmn2r78 UTSW 7 86,603,513 (GRCm39) missense possibly damaging 0.81
R9209:Vmn2r78 UTSW 7 86,569,431 (GRCm39) missense probably benign 0.08
RF018:Vmn2r78 UTSW 7 86,603,639 (GRCm39) nonsense probably null
Z1177:Vmn2r78 UTSW 7 86,603,982 (GRCm39) missense probably benign 0.02
Z1177:Vmn2r78 UTSW 7 86,570,415 (GRCm39) missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- ACACTGTCTGCTTAGCATTTGTAAC -3'
(R):5'- CAGTGTTTTACAATCAGGTGGTTTC -3'

Sequencing Primer
(F):5'- GGAGATAAAGAATCTCCTCTACA -3'
(R):5'- CAATCAGGTGGTTTCAAAGAACAC -3'
Posted On 2015-08-18