Incidental Mutation 'R4544:Vmn2r78'
ID333679
Institutional Source Beutler Lab
Gene Symbol Vmn2r78
Ensembl Gene ENSMUSG00000091962
Gene Namevomeronasal 2, receptor 78
Synonyms
MMRRC Submission 041779-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R4544 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location86915300-86955177 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86921191 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 306 (M306L)
Ref Sequence ENSEMBL: ENSMUSP00000126698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170835]
Predicted Effect probably benign
Transcript: ENSMUST00000170835
AA Change: M306L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126698
Gene: ENSMUSG00000091962
AA Change: M306L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 75 464 5.9e-31 PFAM
Pfam:NCD3G 507 559 8.1e-21 PFAM
Pfam:7tm_3 592 827 1e-52 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Alg9 C T 9: 50,805,354 T409M possibly damaging Het
Atf7 A G 15: 102,534,327 V449A probably benign Het
C1s1 A G 6: 124,531,540 S497P probably benign Het
Ccnyl1 G T 1: 64,723,576 M347I probably benign Het
Chil4 C A 3: 106,210,606 R116L probably damaging Het
Cmpk2 A G 12: 26,478,017 E411G probably damaging Het
Cmya5 G A 13: 93,091,918 R2221* probably null Het
Csmd1 A T 8: 16,710,636 F161Y possibly damaging Het
Cspg4 T A 9: 56,888,629 L1216Q possibly damaging Het
Dppa3 A G 6: 122,626,767 probably benign Het
Ednra A G 8: 77,674,911 probably null Het
Fancd2 A G 6: 113,572,642 probably null Het
Fastkd1 C T 2: 69,712,311 E51K probably damaging Het
Fndc1 T A 17: 7,773,544 D440V unknown Het
Gm10093 A T 17: 78,492,959 T460S probably benign Het
Gm11808 C T 4: 3,973,244 R106H probably benign Het
Gm9934 A G 7: 93,052,980 noncoding transcript Het
Ifi205 T C 1: 174,026,573 I171M possibly damaging Het
Ifi213 T C 1: 173,582,127 probably null Het
Insig2 A T 1: 121,312,192 probably benign Het
Kdm7a T C 6: 39,175,472 R97G probably benign Het
Krt23 G A 11: 99,478,276 T397M probably benign Het
Lepr G A 4: 101,768,228 V527I possibly damaging Het
Lmo2 C T 2: 103,976,037 P25L probably damaging Het
Lsr C T 7: 30,971,976 V111M probably damaging Het
Mest T C 6: 30,740,680 W13R probably damaging Het
Mfn2 A G 4: 147,887,452 V224A probably benign Het
Mkx T C 18: 7,000,651 Y97C probably damaging Het
Mndal A T 1: 173,875,664 Y58* probably null Het
Myo9b T C 8: 71,327,941 V494A probably damaging Het
Nek1 C T 8: 61,016,304 Q132* probably null Het
Olfr446 C T 6: 42,927,414 S61L probably damaging Het
Olfr774 A C 10: 129,238,158 N3T probably damaging Het
Osbpl6 T C 2: 76,584,492 V409A possibly damaging Het
Pde8a A T 7: 81,328,099 R713S probably damaging Het
Pex10 T C 4: 155,070,495 Y235H probably benign Het
Pik3cb T A 9: 99,039,759 K1050I probably damaging Het
Prss56 A G 1: 87,184,642 D85G probably damaging Het
Psg26 T C 7: 18,478,539 N297S probably damaging Het
Rdh16f1 T C 10: 127,790,837 L253S probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc7a8 C G 14: 54,735,790 G240A possibly damaging Het
Slc8b1 G A 5: 120,531,153 probably null Het
Sorbs1 G A 19: 40,311,850 T575M probably damaging Het
Syne3 T A 12: 104,959,469 K313M probably damaging Het
Tas2r108 A G 6: 40,493,808 T73A probably benign Het
Ttn T C 2: 76,822,588 probably null Het
Ubr3 G A 2: 69,956,093 M850I probably benign Het
Vmn2r9 T G 5: 108,847,685 M366L probably benign Het
Zan C G 5: 137,383,834 M5150I unknown Het
Other mutations in Vmn2r78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Vmn2r78 APN 7 86915361 missense unknown
IGL01473:Vmn2r78 APN 7 86920312 missense possibly damaging 0.61
IGL01767:Vmn2r78 APN 7 86954435 missense probably benign 0.28
IGL02322:Vmn2r78 APN 7 86921479 missense probably damaging 0.96
IGL02537:Vmn2r78 APN 7 86954288 missense probably damaging 0.99
IGL03297:Vmn2r78 APN 7 86920761 nonsense probably null
ANU74:Vmn2r78 UTSW 7 86921065 missense possibly damaging 0.62
R0035:Vmn2r78 UTSW 7 86920205 missense probably benign 0.22
R0081:Vmn2r78 UTSW 7 86923027 missense probably benign 0.35
R0401:Vmn2r78 UTSW 7 86921311 missense probably benign 0.04
R0751:Vmn2r78 UTSW 7 86954380 missense possibly damaging 0.77
R1341:Vmn2r78 UTSW 7 86922269 missense possibly damaging 0.71
R1386:Vmn2r78 UTSW 7 86915407 missense unknown
R1526:Vmn2r78 UTSW 7 86922257 splice site probably null
R1712:Vmn2r78 UTSW 7 86954924 missense probably damaging 1.00
R1739:Vmn2r78 UTSW 7 86920789 missense probably benign
R1812:Vmn2r78 UTSW 7 86920787 missense probably benign 0.38
R2011:Vmn2r78 UTSW 7 86955079 missense possibly damaging 0.52
R2144:Vmn2r78 UTSW 7 86954482 missense probably damaging 1.00
R2197:Vmn2r78 UTSW 7 86921327 missense probably damaging 0.96
R2291:Vmn2r78 UTSW 7 86920154 missense probably damaging 1.00
R2409:Vmn2r78 UTSW 7 86920745 splice site probably benign
R3023:Vmn2r78 UTSW 7 86954966 missense probably damaging 1.00
R4486:Vmn2r78 UTSW 7 86920751 critical splice acceptor site probably null
R4512:Vmn2r78 UTSW 7 86920244 missense probably benign 0.00
R4515:Vmn2r78 UTSW 7 86954258 missense probably damaging 0.99
R4546:Vmn2r78 UTSW 7 86954603 missense probably damaging 1.00
R4872:Vmn2r78 UTSW 7 86954708 missense possibly damaging 0.87
R4928:Vmn2r78 UTSW 7 86954627 missense probably damaging 1.00
R5101:Vmn2r78 UTSW 7 86922355 missense probably damaging 1.00
R5265:Vmn2r78 UTSW 7 86920124 missense probably damaging 1.00
R5328:Vmn2r78 UTSW 7 86921030 missense probably damaging 0.98
R5442:Vmn2r78 UTSW 7 86920122 missense possibly damaging 0.95
R5567:Vmn2r78 UTSW 7 86921529 missense probably benign 0.17
R5572:Vmn2r78 UTSW 7 86915512 missense probably benign 0.01
R5636:Vmn2r78 UTSW 7 86954429 missense probably damaging 0.99
R5901:Vmn2r78 UTSW 7 86954588 missense probably damaging 1.00
R5977:Vmn2r78 UTSW 7 86920333 missense possibly damaging 0.74
R5977:Vmn2r78 UTSW 7 86954907 missense probably benign 0.00
R6276:Vmn2r78 UTSW 7 86921110 missense probably benign 0.00
R6386:Vmn2r78 UTSW 7 86922337 nonsense probably null
R6724:Vmn2r78 UTSW 7 86954258 missense probably damaging 0.99
R6852:Vmn2r78 UTSW 7 86954603 missense probably damaging 1.00
R6896:Vmn2r78 UTSW 7 86922350 missense probably benign 0.10
R7385:Vmn2r78 UTSW 7 86922425 missense probably benign 0.18
R7578:Vmn2r78 UTSW 7 86954344 nonsense probably null
R7680:Vmn2r78 UTSW 7 86954941 missense probably damaging 1.00
R7748:Vmn2r78 UTSW 7 86921135 missense probably benign 0.00
R7852:Vmn2r78 UTSW 7 86920170 nonsense probably null
R8031:Vmn2r78 UTSW 7 86954867 missense probably damaging 1.00
R8070:Vmn2r78 UTSW 7 86922487 missense probably benign 0.01
R8085:Vmn2r78 UTSW 7 86954790 missense probably benign 0.00
R8163:Vmn2r78 UTSW 7 86954452 missense probably damaging 1.00
R8501:Vmn2r78 UTSW 7 86920886 missense probably damaging 0.99
R8749:Vmn2r78 UTSW 7 86954305 missense possibly damaging 0.81
RF018:Vmn2r78 UTSW 7 86954431 nonsense probably null
Z1177:Vmn2r78 UTSW 7 86921207 missense probably benign 0.44
Z1177:Vmn2r78 UTSW 7 86954774 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACACTGTCTGCTTAGCATTTGTAAC -3'
(R):5'- CAGTGTTTTACAATCAGGTGGTTTC -3'

Sequencing Primer
(F):5'- GGAGATAAAGAATCTCCTCTACA -3'
(R):5'- CAATCAGGTGGTTTCAAAGAACAC -3'
Posted On2015-08-18