Incidental Mutation 'R4544:Myo9b'
ID 333682
Institutional Source Beutler Lab
Gene Symbol Myo9b
Ensembl Gene ENSMUSG00000004677
Gene Name myosin IXb
Synonyms
MMRRC Submission 041779-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.852) question?
Stock # R4544 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 71725358-71813357 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 71780585 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 494 (V494A)
Ref Sequence ENSEMBL: ENSMUSP00000148316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071935] [ENSMUST00000168839] [ENSMUST00000170242] [ENSMUST00000212935]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000071935
AA Change: V494A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071827
Gene: ENSMUSG00000004677
AA Change: V494A

DomainStartEndE-ValueType
RA 15 114 3.7e-30 SMART
MYSc 140 954 N/A SMART
IQ 955 977 1.2e-3 SMART
IQ 978 1000 1.6e-5 SMART
IQ 1001 1022 4.3e-5 SMART
IQ 1023 1045 8.4e-5 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1232 1246 N/A INTRINSIC
Blast:MYSc 1247 1323 3e-19 BLAST
low complexity region 1348 1359 N/A INTRINSIC
coiled coil region 1563 1590 N/A INTRINSIC
C1 1591 1639 1.7e-14 SMART
RhoGAP 1668 1843 4.7e-71 SMART
coiled coil region 1901 1925 N/A INTRINSIC
low complexity region 1940 1952 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168839
AA Change: V494A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131635
Gene: ENSMUSG00000004677
AA Change: V494A

DomainStartEndE-ValueType
RA 15 114 5.79e-28 SMART
MYSc 140 954 N/A SMART
IQ 955 977 2.46e-1 SMART
IQ 978 1000 3.35e-3 SMART
IQ 1001 1022 8.84e-3 SMART
IQ 1023 1045 1.77e-2 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1234 1257 N/A INTRINSIC
Blast:MYSc 1258 1334 3e-19 BLAST
low complexity region 1361 1372 N/A INTRINSIC
low complexity region 1581 1601 N/A INTRINSIC
C1 1605 1653 3.58e-12 SMART
RhoGAP 1682 1857 7.78e-69 SMART
coiled coil region 1915 1939 N/A INTRINSIC
low complexity region 1954 1966 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170242
AA Change: V494A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129220
Gene: ENSMUSG00000004677
AA Change: V494A

DomainStartEndE-ValueType
RA 15 114 5.79e-28 SMART
MYSc 140 954 N/A SMART
IQ 955 977 2.46e-1 SMART
IQ 978 1000 3.35e-3 SMART
IQ 1001 1022 8.84e-3 SMART
IQ 1023 1045 1.77e-2 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1234 1257 N/A INTRINSIC
Blast:MYSc 1258 1334 3e-19 BLAST
low complexity region 1361 1372 N/A INTRINSIC
low complexity region 1581 1601 N/A INTRINSIC
C1 1605 1653 3.58e-12 SMART
RhoGAP 1682 1857 7.78e-69 SMART
coiled coil region 1931 1955 N/A INTRINSIC
low complexity region 1970 1982 N/A INTRINSIC
low complexity region 1992 2003 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000212935
AA Change: V494A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6783 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin family of actin-based molecular motor heavy chain proteins. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-9 (MYH9). The protein has four IQ motifs located in the neck domain that bind calmodulin, which serves as a light chain. The protein complex has a single-headed structure and exhibits processive movement on actin filaments toward the minus-end. The protein also has rho-GTPase activity. Polymorphisms in this gene are associated with celiac disease and ulcerative colitis susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mutants breed normal, but shows defect in macrophage motility and chemotaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 A C 13: 4,557,843 (GRCm39) V201G probably damaging Het
Alg9 C T 9: 50,716,654 (GRCm39) T409M possibly damaging Het
Atf7 A G 15: 102,442,762 (GRCm39) V449A probably benign Het
C1s1 A G 6: 124,508,499 (GRCm39) S497P probably benign Het
Ccnyl1 G T 1: 64,762,735 (GRCm39) M347I probably benign Het
Chil4 C A 3: 106,117,922 (GRCm39) R116L probably damaging Het
Cmpk2 A G 12: 26,528,016 (GRCm39) E411G probably damaging Het
Cmya5 G A 13: 93,228,426 (GRCm39) R2221* probably null Het
Csmd1 A T 8: 16,760,652 (GRCm39) F161Y possibly damaging Het
Cspg4 T A 9: 56,795,913 (GRCm39) L1216Q possibly damaging Het
Dppa3 A G 6: 122,603,726 (GRCm39) probably benign Het
Ednra A G 8: 78,401,540 (GRCm39) probably null Het
Fancd2 A G 6: 113,549,603 (GRCm39) probably null Het
Fastkd1 C T 2: 69,542,655 (GRCm39) E51K probably damaging Het
Fndc1 T A 17: 7,992,376 (GRCm39) D440V unknown Het
Gm9934 A G 7: 92,702,188 (GRCm39) noncoding transcript Het
Hdac1-ps A T 17: 78,800,388 (GRCm39) T460S probably benign Het
Ifi205 T C 1: 173,854,139 (GRCm39) I171M possibly damaging Het
Ifi213 T C 1: 173,409,693 (GRCm39) probably null Het
Insig2 A T 1: 121,239,921 (GRCm39) probably benign Het
Kdm7a T C 6: 39,152,406 (GRCm39) R97G probably benign Het
Krt23 G A 11: 99,369,102 (GRCm39) T397M probably benign Het
Lepr G A 4: 101,625,425 (GRCm39) V527I possibly damaging Het
Lmo2 C T 2: 103,806,382 (GRCm39) P25L probably damaging Het
Lsr C T 7: 30,671,401 (GRCm39) V111M probably damaging Het
Mest T C 6: 30,740,679 (GRCm39) W13R probably damaging Het
Mfn2 A G 4: 147,971,909 (GRCm39) V224A probably benign Het
Mkx T C 18: 7,000,651 (GRCm39) Y97C probably damaging Het
Mndal A T 1: 173,703,230 (GRCm39) Y58* probably null Het
Nek1 C T 8: 61,469,338 (GRCm39) Q132* probably null Het
Or2a12 C T 6: 42,904,348 (GRCm39) S61L probably damaging Het
Or6c5 A C 10: 129,074,027 (GRCm39) N3T probably damaging Het
Osbpl6 T C 2: 76,414,836 (GRCm39) V409A possibly damaging Het
Pde8a A T 7: 80,977,847 (GRCm39) R713S probably damaging Het
Pex10 T C 4: 155,154,952 (GRCm39) Y235H probably benign Het
Pik3cb T A 9: 98,921,812 (GRCm39) K1050I probably damaging Het
Prss56 A G 1: 87,112,364 (GRCm39) D85G probably damaging Het
Psg26 T C 7: 18,212,464 (GRCm39) N297S probably damaging Het
Rdh16f1 T C 10: 127,626,706 (GRCm39) L253S probably benign Het
Slc15a4 A G 5: 127,681,600 (GRCm39) probably null Het
Slc7a8 C G 14: 54,973,247 (GRCm39) G240A possibly damaging Het
Slc8b1 G A 5: 120,669,218 (GRCm39) probably null Het
Sorbs1 G A 19: 40,300,294 (GRCm39) T575M probably damaging Het
Syne3 T A 12: 104,925,728 (GRCm39) K313M probably damaging Het
Tas2r108 A G 6: 40,470,742 (GRCm39) T73A probably benign Het
Ttn T C 2: 76,652,932 (GRCm39) probably null Het
Uba52rt C T 4: 3,973,244 (GRCm39) R106H probably benign Het
Ubr3 G A 2: 69,786,437 (GRCm39) M850I probably benign Het
Vmn2r78 A T 7: 86,570,399 (GRCm39) M306L probably benign Het
Vmn2r9 T G 5: 108,995,551 (GRCm39) M366L probably benign Het
Zan C G 5: 137,382,096 (GRCm39) M5150I unknown Het
Other mutations in Myo9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Myo9b APN 8 71,801,379 (GRCm39) missense probably benign
IGL01020:Myo9b APN 8 71,804,644 (GRCm39) missense probably benign
IGL01479:Myo9b APN 8 71,811,986 (GRCm39) missense probably damaging 1.00
IGL01704:Myo9b APN 8 71,812,286 (GRCm39) missense probably damaging 0.98
IGL01761:Myo9b APN 8 71,801,796 (GRCm39) missense probably damaging 0.96
IGL01766:Myo9b APN 8 71,743,161 (GRCm39) missense probably damaging 1.00
IGL01834:Myo9b APN 8 71,807,901 (GRCm39) missense possibly damaging 0.93
IGL01834:Myo9b APN 8 71,808,962 (GRCm39) missense probably damaging 1.00
IGL01838:Myo9b APN 8 71,787,034 (GRCm39) missense probably damaging 0.99
IGL02318:Myo9b APN 8 71,806,768 (GRCm39) missense probably damaging 0.98
IGL02333:Myo9b APN 8 71,811,637 (GRCm39) missense possibly damaging 0.65
IGL02340:Myo9b APN 8 71,743,689 (GRCm39) missense probably damaging 1.00
IGL02514:Myo9b APN 8 71,743,650 (GRCm39) missense probably damaging 1.00
IGL02593:Myo9b APN 8 71,743,417 (GRCm39) missense probably damaging 1.00
IGL03075:Myo9b APN 8 71,807,171 (GRCm39) missense probably damaging 1.00
IGL03332:Myo9b APN 8 71,801,418 (GRCm39) missense possibly damaging 0.78
avantgarde UTSW 8 71,796,806 (GRCm39) missense probably damaging 1.00
Freaky UTSW 8 71,743,463 (GRCm39) missense probably damaging 1.00
iconoclastic UTSW 8 71,743,119 (GRCm39) missense probably benign 0.37
unconventional UTSW 8 71,801,241 (GRCm39) missense probably benign 0.00
PIT4418001:Myo9b UTSW 8 71,775,591 (GRCm39) missense probably damaging 1.00
PIT4651001:Myo9b UTSW 8 71,795,456 (GRCm39) missense possibly damaging 0.83
R0023:Myo9b UTSW 8 71,786,412 (GRCm39) missense probably damaging 1.00
R0103:Myo9b UTSW 8 71,776,493 (GRCm39) splice site probably benign
R0103:Myo9b UTSW 8 71,776,493 (GRCm39) splice site probably benign
R0144:Myo9b UTSW 8 71,798,687 (GRCm39) missense probably damaging 1.00
R0207:Myo9b UTSW 8 71,807,869 (GRCm39) splice site probably benign
R0226:Myo9b UTSW 8 71,806,476 (GRCm39) missense probably damaging 1.00
R0227:Myo9b UTSW 8 71,796,806 (GRCm39) missense probably damaging 1.00
R0244:Myo9b UTSW 8 71,774,457 (GRCm39) missense probably damaging 1.00
R0277:Myo9b UTSW 8 71,808,596 (GRCm39) splice site probably benign
R0362:Myo9b UTSW 8 71,800,414 (GRCm39) missense probably damaging 1.00
R0689:Myo9b UTSW 8 71,783,400 (GRCm39) missense probably damaging 1.00
R0844:Myo9b UTSW 8 71,743,119 (GRCm39) missense probably benign 0.37
R1051:Myo9b UTSW 8 71,808,466 (GRCm39) missense probably damaging 1.00
R1469:Myo9b UTSW 8 71,743,680 (GRCm39) missense probably damaging 1.00
R1469:Myo9b UTSW 8 71,743,680 (GRCm39) missense probably damaging 1.00
R1526:Myo9b UTSW 8 71,808,408 (GRCm39) missense probably damaging 1.00
R1544:Myo9b UTSW 8 71,743,620 (GRCm39) missense probably damaging 1.00
R1565:Myo9b UTSW 8 71,767,836 (GRCm39) missense possibly damaging 0.46
R1645:Myo9b UTSW 8 71,775,622 (GRCm39) missense probably damaging 1.00
R1745:Myo9b UTSW 8 71,806,691 (GRCm39) missense probably damaging 1.00
R1820:Myo9b UTSW 8 71,786,002 (GRCm39) missense probably damaging 1.00
R2037:Myo9b UTSW 8 71,743,510 (GRCm39) missense probably damaging 1.00
R2050:Myo9b UTSW 8 71,743,194 (GRCm39) missense probably damaging 1.00
R2056:Myo9b UTSW 8 71,812,334 (GRCm39) missense possibly damaging 0.78
R2129:Myo9b UTSW 8 71,786,343 (GRCm39) missense probably damaging 1.00
R2423:Myo9b UTSW 8 71,780,584 (GRCm39) missense probably damaging 1.00
R2869:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2869:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2871:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2871:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2872:Myo9b UTSW 8 71,743,610 (GRCm39) missense probably benign 0.01
R2872:Myo9b UTSW 8 71,743,610 (GRCm39) missense probably benign 0.01
R2873:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2874:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2920:Myo9b UTSW 8 71,778,501 (GRCm39) missense probably damaging 0.98
R2926:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2939:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2940:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R3033:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R3040:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R3689:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R3691:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R3735:Myo9b UTSW 8 71,801,241 (GRCm39) missense probably benign 0.00
R4194:Myo9b UTSW 8 71,812,268 (GRCm39) missense possibly damaging 0.71
R4258:Myo9b UTSW 8 71,808,409 (GRCm39) missense probably damaging 1.00
R4457:Myo9b UTSW 8 71,743,643 (GRCm39) missense probably damaging 1.00
R4478:Myo9b UTSW 8 71,743,725 (GRCm39) missense probably damaging 1.00
R4496:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R4580:Myo9b UTSW 8 71,767,779 (GRCm39) missense probably damaging 1.00
R4736:Myo9b UTSW 8 71,809,236 (GRCm39) missense probably damaging 1.00
R5068:Myo9b UTSW 8 71,801,699 (GRCm39) missense probably damaging 1.00
R5124:Myo9b UTSW 8 71,808,483 (GRCm39) missense probably damaging 1.00
R5194:Myo9b UTSW 8 71,801,733 (GRCm39) missense probably benign 0.01
R5296:Myo9b UTSW 8 71,786,032 (GRCm39) missense possibly damaging 0.69
R5528:Myo9b UTSW 8 71,775,918 (GRCm39) missense probably benign 0.06
R5664:Myo9b UTSW 8 71,812,526 (GRCm39) missense probably benign 0.13
R5677:Myo9b UTSW 8 71,796,330 (GRCm39) missense probably damaging 1.00
R5680:Myo9b UTSW 8 71,743,016 (GRCm39) missense probably benign 0.00
R5982:Myo9b UTSW 8 71,801,040 (GRCm39) missense probably benign 0.05
R6344:Myo9b UTSW 8 71,780,558 (GRCm39) missense probably damaging 1.00
R6352:Myo9b UTSW 8 71,801,055 (GRCm39) missense probably benign
R6352:Myo9b UTSW 8 71,801,054 (GRCm39) missense probably benign 0.16
R6411:Myo9b UTSW 8 71,775,599 (GRCm39) nonsense probably null
R6425:Myo9b UTSW 8 71,786,272 (GRCm39) missense probably damaging 1.00
R6505:Myo9b UTSW 8 71,808,501 (GRCm39) missense possibly damaging 0.88
R6743:Myo9b UTSW 8 71,804,803 (GRCm39) splice site probably null
R6811:Myo9b UTSW 8 71,809,222 (GRCm39) missense probably damaging 1.00
R6813:Myo9b UTSW 8 71,775,949 (GRCm39) missense probably damaging 1.00
R6954:Myo9b UTSW 8 71,743,463 (GRCm39) missense probably damaging 1.00
R7124:Myo9b UTSW 8 71,786,345 (GRCm39) nonsense probably null
R7255:Myo9b UTSW 8 71,743,535 (GRCm39) missense probably damaging 1.00
R7293:Myo9b UTSW 8 71,778,549 (GRCm39) missense probably benign 0.00
R7342:Myo9b UTSW 8 71,808,418 (GRCm39) missense probably damaging 1.00
R7451:Myo9b UTSW 8 71,804,832 (GRCm39) missense probably benign 0.28
R7482:Myo9b UTSW 8 71,795,442 (GRCm39) missense probably benign 0.00
R7508:Myo9b UTSW 8 71,807,445 (GRCm39) missense probably benign 0.00
R7957:Myo9b UTSW 8 71,807,405 (GRCm39) missense probably benign 0.12
R8062:Myo9b UTSW 8 71,774,457 (GRCm39) missense probably damaging 0.99
R8108:Myo9b UTSW 8 71,800,986 (GRCm39) missense probably damaging 0.99
R8197:Myo9b UTSW 8 71,743,607 (GRCm39) missense probably damaging 1.00
R8274:Myo9b UTSW 8 71,812,480 (GRCm39) missense probably benign 0.00
R8686:Myo9b UTSW 8 71,786,966 (GRCm39) missense probably benign 0.01
R8731:Myo9b UTSW 8 71,806,486 (GRCm39) critical splice donor site probably null
R8924:Myo9b UTSW 8 71,801,675 (GRCm39) missense probably benign
R9056:Myo9b UTSW 8 71,804,906 (GRCm39) missense probably benign 0.17
R9117:Myo9b UTSW 8 71,800,451 (GRCm39) missense probably benign 0.03
R9151:Myo9b UTSW 8 71,807,871 (GRCm39) splice site probably benign
R9315:Myo9b UTSW 8 71,801,811 (GRCm39) missense possibly damaging 0.54
R9332:Myo9b UTSW 8 71,812,246 (GRCm39) missense probably benign 0.07
R9364:Myo9b UTSW 8 71,808,483 (GRCm39) missense probably damaging 1.00
R9569:Myo9b UTSW 8 71,811,629 (GRCm39) missense probably benign
R9581:Myo9b UTSW 8 71,812,543 (GRCm39) missense probably benign 0.19
R9600:Myo9b UTSW 8 71,743,075 (GRCm39) missense possibly damaging 0.80
X0066:Myo9b UTSW 8 71,776,542 (GRCm39) missense probably damaging 1.00
Z1177:Myo9b UTSW 8 71,743,353 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATTAAGCAGACTTCAGCAGG -3'
(R):5'- TAAGAATCCTCTGCCAGCCCTG -3'

Sequencing Primer
(F):5'- TGATCTGCAATCCCAGCCTATGAG -3'
(R):5'- CCTGGTATTTGCAGAGATCCCATAG -3'
Posted On 2015-08-18