Incidental Mutation 'R4544:Alg9'
ID333684
Institutional Source Beutler Lab
Gene Symbol Alg9
Ensembl Gene ENSMUSG00000032059
Gene Nameasparagine-linked glycosylation 9 (alpha 1,2 mannosyltransferase)
SynonymsB430313H07Rik, 8230402H15Rik, Dibd1
MMRRC Submission 041779-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4544 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location50775019-50843542 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 50805354 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 409 (T409M)
Ref Sequence ENSEMBL: ENSMUSP00000034561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034561] [ENSMUST00000162073] [ENSMUST00000177320]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034561
AA Change: T409M

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034561
Gene: ENSMUSG00000032059
AA Change: T409M

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 60 482 3.5e-127 PFAM
low complexity region 598 611 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162073
SMART Domains Protein: ENSMUSP00000125425
Gene: ENSMUSG00000032059

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 60 167 7.5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175728
Predicted Effect possibly damaging
Transcript: ENSMUST00000177320
AA Change: T26M

PolyPhen 2 Score 0.548 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134818
Gene: ENSMUSG00000032059
AA Change: T26M

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 2 99 4.3e-15 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha-1,2-mannosyltransferase enzyme that functions in lipid-linked oligosaccharide assembly. Mutations in this gene result in congenital disorder of glycosylation type Il. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Atf7 A G 15: 102,534,327 V449A probably benign Het
C1s1 A G 6: 124,531,540 S497P probably benign Het
Ccnyl1 G T 1: 64,723,576 M347I probably benign Het
Chil4 C A 3: 106,210,606 R116L probably damaging Het
Cmpk2 A G 12: 26,478,017 E411G probably damaging Het
Cmya5 G A 13: 93,091,918 R2221* probably null Het
Csmd1 A T 8: 16,710,636 F161Y possibly damaging Het
Cspg4 T A 9: 56,888,629 L1216Q possibly damaging Het
Dppa3 A G 6: 122,626,767 probably benign Het
Ednra A G 8: 77,674,911 probably null Het
Fancd2 A G 6: 113,572,642 probably null Het
Fastkd1 C T 2: 69,712,311 E51K probably damaging Het
Fndc1 T A 17: 7,773,544 D440V unknown Het
Gm10093 A T 17: 78,492,959 T460S probably benign Het
Gm11808 C T 4: 3,973,244 R106H probably benign Het
Gm9934 A G 7: 93,052,980 noncoding transcript Het
Ifi205 T C 1: 174,026,573 I171M possibly damaging Het
Ifi213 T C 1: 173,582,127 probably null Het
Insig2 A T 1: 121,312,192 probably benign Het
Kdm7a T C 6: 39,175,472 R97G probably benign Het
Krt23 G A 11: 99,478,276 T397M probably benign Het
Lepr G A 4: 101,768,228 V527I possibly damaging Het
Lmo2 C T 2: 103,976,037 P25L probably damaging Het
Lsr C T 7: 30,971,976 V111M probably damaging Het
Mest T C 6: 30,740,680 W13R probably damaging Het
Mfn2 A G 4: 147,887,452 V224A probably benign Het
Mkx T C 18: 7,000,651 Y97C probably damaging Het
Mndal A T 1: 173,875,664 Y58* probably null Het
Myo9b T C 8: 71,327,941 V494A probably damaging Het
Nek1 C T 8: 61,016,304 Q132* probably null Het
Olfr446 C T 6: 42,927,414 S61L probably damaging Het
Olfr774 A C 10: 129,238,158 N3T probably damaging Het
Osbpl6 T C 2: 76,584,492 V409A possibly damaging Het
Pde8a A T 7: 81,328,099 R713S probably damaging Het
Pex10 T C 4: 155,070,495 Y235H probably benign Het
Pik3cb T A 9: 99,039,759 K1050I probably damaging Het
Prss56 A G 1: 87,184,642 D85G probably damaging Het
Psg26 T C 7: 18,478,539 N297S probably damaging Het
Rdh16f1 T C 10: 127,790,837 L253S probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc7a8 C G 14: 54,735,790 G240A possibly damaging Het
Slc8b1 G A 5: 120,531,153 probably null Het
Sorbs1 G A 19: 40,311,850 T575M probably damaging Het
Syne3 T A 12: 104,959,469 K313M probably damaging Het
Tas2r108 A G 6: 40,493,808 T73A probably benign Het
Ttn T C 2: 76,822,588 probably null Het
Ubr3 G A 2: 69,956,093 M850I probably benign Het
Vmn2r78 A T 7: 86,921,191 M306L probably benign Het
Vmn2r9 T G 5: 108,847,685 M366L probably benign Het
Zan C G 5: 137,383,834 M5150I unknown Het
Other mutations in Alg9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Alg9 APN 9 50775377 splice site probably null
IGL02792:Alg9 APN 9 50842748 missense possibly damaging 0.90
gum_drop UTSW 9 50805354 missense possibly damaging 0.90
FR4976:Alg9 UTSW 9 50775431 unclassified probably benign
R1183:Alg9 UTSW 9 50789533 missense possibly damaging 0.82
R1270:Alg9 UTSW 9 50787572 intron probably benign
R1575:Alg9 UTSW 9 50775502 missense possibly damaging 0.65
R1773:Alg9 UTSW 9 50779096 missense probably benign 0.30
R1837:Alg9 UTSW 9 50806315 missense probably damaging 1.00
R2011:Alg9 UTSW 9 50788200 missense probably damaging 1.00
R4324:Alg9 UTSW 9 50805343 missense probably damaging 1.00
R4514:Alg9 UTSW 9 50805354 missense possibly damaging 0.90
R4546:Alg9 UTSW 9 50805354 missense possibly damaging 0.90
R4996:Alg9 UTSW 9 50808705 missense probably damaging 1.00
R5007:Alg9 UTSW 9 50788224 missense probably damaging 1.00
R5053:Alg9 UTSW 9 50788172 missense probably damaging 1.00
R5308:Alg9 UTSW 9 50822711 missense possibly damaging 0.95
R6803:Alg9 UTSW 9 50789560 missense probably benign 0.37
R6994:Alg9 UTSW 9 50792122 nonsense probably null
R6998:Alg9 UTSW 9 50789621 missense possibly damaging 0.95
R7298:Alg9 UTSW 9 50779061 missense probably damaging 0.97
R7480:Alg9 UTSW 9 50822628 missense probably benign 0.06
R7561:Alg9 UTSW 9 50842774 missense possibly damaging 0.95
R7578:Alg9 UTSW 9 50789535 missense probably benign
R7721:Alg9 UTSW 9 50776642 missense probably damaging 0.99
R7829:Alg9 UTSW 9 50788171 missense probably damaging 1.00
R7847:Alg9 UTSW 9 50789605 missense possibly damaging 0.62
R7878:Alg9 UTSW 9 50842783 missense probably benign 0.00
R8113:Alg9 UTSW 9 50808780 nonsense probably null
R8257:Alg9 UTSW 9 50779087 missense possibly damaging 0.62
RF003:Alg9 UTSW 9 50775427 unclassified probably benign
RF006:Alg9 UTSW 9 50775417 unclassified probably benign
RF058:Alg9 UTSW 9 50775427 unclassified probably benign
Z1177:Alg9 UTSW 9 50788173 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGACCCTTGTCACACCTG -3'
(R):5'- GTACAGAGGTCACATCCCAC -3'

Sequencing Primer
(F):5'- ACACCTGCTGTTCTGCGTG -3'
(R):5'- ACATGACTTCCCTTTGAGAGCAG -3'
Posted On2015-08-18