Mutagenetix > Incidental Mutation

Incidental Mutation 'R0207:Itch'

33370

Institutional Source

Beutler Lab

Gene Symbol

Itch

Ensembl Gene

ENSMUSG00000027598

Gene Name

itchy, E3 ubiquitin protein ligase

Synonyms

8030492O04Rik, C230047C07Rik, 6720481N21Rik, AIP4

MMRRC Submission

038460-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0207 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

155133509-155226855 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 155202257 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 494 (Q494L)

Ref Sequence

ENSEMBL: ENSMUSP00000105307 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029126] [ENSMUST00000109685]

AlphaFold

Q8C863

Predicted Effect

probably benign
Transcript: ENSMUST00000029126
AA Change: Q494L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000029126
Gene: ENSMUSG00000027598
AA Change: Q494L

Domain	Start	End	E-Value	Type
C2	19	114	3.56e-12	SMART
low complexity region	195	206	N/A	INTRINSIC
low complexity region	209	226	N/A	INTRINSIC
low complexity region	230	259	N/A	INTRINSIC
WW	288	320	1.07e-12	SMART
WW	321	352	3.86e-10	SMART
WW	400	432	7.36e-16	SMART
WW	440	472	6.82e-11	SMART
HECTc	528	864	7.04e-179	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109685
AA Change: Q494L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000105307
Gene: ENSMUSG00000027598
AA Change: Q494L

Domain	Start	End	E-Value	Type
C2	19	114	3.56e-12	SMART
low complexity region	195	206	N/A	INTRINSIC
low complexity region	209	226	N/A	INTRINSIC
low complexity region	230	259	N/A	INTRINSIC
WW	288	320	1.07e-12	SMART
WW	321	352	3.86e-10	SMART
WW	400	432	7.36e-16	SMART
WW	440	472	6.82e-11	SMART
HECTc	528	864	7.04e-179	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000119431

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123497

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142147

Meta Mutation Damage Score

0.0693

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.2%
20x: 95.5%

Validation Efficiency

95% (76/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein plays a role in multiple cellular processes including erythroid and lymphoid cell differentiation and the regulation of immune responses. Mutations in this gene are a cause of syndromic multisystem autoimmune disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for an ENU mutation exhibit increased total IgE levels in the peripheral blood and an enhanced IgE response to the cysteine protease allergen, papain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	A	G	4: 53,086,039	F488S	probably damaging	Het
Acap3	C	T	4: 155,899,424	R116W	probably damaging	Het
Adamts10	C	A	17: 33,545,390	P663T	possibly damaging	Het
Akap12	G	A	10: 4,353,333	G48S	probably damaging	Het
Ankrd7	T	A	6: 18,870,031	M261K	probably benign	Het
Ankzf1	C	A	1: 75,198,304	D599E	possibly damaging	Het
Aox1	T	C	1: 58,105,014	I1278T	possibly damaging	Het
Apcdd1	T	C	18: 62,950,079	Y327H	probably benign	Het
Asxl3	T	A	18: 22,411,496		probably benign	Het
Birc6	C	A	17: 74,662,832		probably benign	Het
Btaf1	T	A	19: 37,009,648	L1714*	probably null	Het
Cacng6	T	A	7: 3,425,004		probably benign	Het
Cdc20b	A	G	13: 113,078,612	D238G	probably damaging	Het
Celf5	T	A	10: 81,470,698	R113W	probably null	Het
Cfap70	C	A	14: 20,412,347	E659D	probably damaging	Het
Clspn	T	A	4: 126,590,598	M1183K	possibly damaging	Het
Dpy19l1	G	A	9: 24,453,891	R275C	probably damaging	Het
Dst	C	T	1: 34,186,935	S1721L	probably benign	Het
Faap100	T	C	11: 120,374,365	T562A	probably damaging	Het
Fam168b	T	C	1: 34,819,688	M133V	probably damaging	Het
Farp2	T	C	1: 93,569,087	I172T	probably damaging	Het
Fer	T	G	17: 63,896,278	S68A	probably damaging	Het
Fmo5	A	G	3: 97,645,681	E315G	probably damaging	Het
Gpr89	A	T	3: 96,871,480	F426I	probably damaging	Het
Hinfp	T	C	9: 44,296,327	I461V	possibly damaging	Het
Hsd11b1	A	T	1: 193,240,248	V167D	probably damaging	Het
Htt	A	G	5: 34,896,908	K2574E	probably benign	Het
I830077J02Rik	A	G	3: 105,926,505	S112P	probably benign	Het
Igf2bp3	T	A	6: 49,105,617	M344L	probably benign	Het
Itga9	T	C	9: 118,769,253		probably benign	Het
Jaml	T	A	9: 45,093,767	D152E	probably benign	Het
Kif22	A	C	7: 127,042,400	M1R	probably null	Het
Kifap3	T	C	1: 163,883,386	Y663H	probably benign	Het
Letm2	T	A	8: 25,578,770	N472I	probably damaging	Het
Mthfr	T	G	4: 148,052,224	V446G	probably damaging	Het
Myh11	T	C	16: 14,211,260	E1206G	possibly damaging	Het
Myo6	G	A	9: 80,288,056	V903I	probably damaging	Het
Myo9b	C	T	8: 71,355,225		probably benign	Het
Nr2f2	G	C	7: 70,360,175	P52R	probably damaging	Het
Nsd3	A	G	8: 25,683,257	N859S	probably benign	Het
Nucb2	C	A	7: 116,536,010	A384E	probably damaging	Het
Ogdhl	C	A	14: 32,342,037		probably null	Het
Olfr119	C	A	17: 37,701,058	C129*	probably null	Het
Olfr1247	G	A	2: 89,609,863	L80F	probably damaging	Het
Olfr1357	T	C	10: 78,611,871	T257A	probably benign	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr381	A	T	11: 73,486,575	L83Q	probably benign	Het
Parp10	C	T	15: 76,242,633	S145N	probably benign	Het
Pigh	A	G	12: 79,083,709		probably benign	Het
Pigo	A	G	4: 43,023,824		probably benign	Het
Pkp4	T	A	2: 59,305,488	V199D	possibly damaging	Het
Polr1e	C	A	4: 45,025,143		probably null	Het
Ppfia3	C	A	7: 45,348,534	R723L	probably damaging	Het
Prex1	C	A	2: 166,585,898	A945S	possibly damaging	Het
Prrt3	A	T	6: 113,495,840	V457E	probably damaging	Het
Rab39	A	G	9: 53,705,971	F49L	possibly damaging	Het
Rrs1	C	A	1: 9,545,762		probably null	Het
Rrs1	G	A	1: 9,545,767	E82K	probably damaging	Het
Serpinb3c	T	C	1: 107,276,992	D8G	probably benign	Het
Slc17a6	A	G	7: 51,646,180		probably benign	Het
Slc24a4	T	A	12: 102,228,951		probably null	Het
Smc1b	C	T	15: 85,123,759	M272I	probably benign	Het
Smc6	T	C	12: 11,283,178		probably benign	Het
Tcf20	T	C	15: 82,855,085	T722A	probably benign	Het
Tesmin	A	T	19: 3,404,088	M141L	probably benign	Het
Tmprss5	T	A	9: 49,113,160	H274Q	possibly damaging	Het
Tns1	C	T	1: 73,937,318		probably null	Het
Tpr	T	C	1: 150,417,427	S868P	possibly damaging	Het
Trank1	C	T	9: 111,366,253	T1115I	probably damaging	Het
Trmt44	A	T	5: 35,572,917	I203K	possibly damaging	Het
Ulk2	A	T	11: 61,777,785	V1037E	probably benign	Het
Usp43	A	G	11: 67,876,499	Y682H	probably damaging	Het
Vipr2	A	T	12: 116,142,882	Q366L	probably damaging	Het
Vmn1r185	C	A	7: 26,611,589	V164L	possibly damaging	Het
Vmn2r120	C	T	17: 57,525,052	V246I	probably benign	Het
Wdr66	T	C	5: 123,283,447	V182A	probably damaging	Het
Wiz	C	T	17: 32,357,033	G790R	probably damaging	Het
Wnk1	A	T	6: 119,952,733	S1016R	probably damaging	Het
Zc3hav1	A	G	6: 38,311,174	L909S	probably benign	Het
Zfp236	T	A	18: 82,640,227	I637F	probably damaging	Het
Zfp788	G	A	7: 41,649,596	G532D	probably damaging	Het
Zranb1	T	C	7: 132,950,385	I255T	probably damaging	Het

Other mutations in Itch

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Itch	APN	2	155213023	missense	probably damaging	1.00
IGL00796:Itch	APN	2	155209082	missense	probably damaging	0.97
IGL01090:Itch	APN	2	155206336	missense	probably damaging	0.99
IGL01568:Itch	APN	2	155212462	splice site	probably benign
IGL01844:Itch	APN	2	155172547	missense	possibly damaging	0.56
IGL01844:Itch	APN	2	155172486	missense	possibly damaging	0.94
IGL01873:Itch	APN	2	155168750	missense	possibly damaging	0.68
IGL02129:Itch	APN	2	155217988	splice site	probably benign
IGL02386:Itch	APN	2	155202261	nonsense	probably null
IGL02545:Itch	APN	2	155172586	splice site	probably null
IGL02621:Itch	APN	2	155172584	splice site	probably null
IGL02708:Itch	APN	2	155174044	missense	probably benign	0.00
IGL02869:Itch	APN	2	155173933	critical splice acceptor site	probably null
Abrade	UTSW	2	155209078	missense	possibly damaging	0.93
dorsolateral	UTSW	2	155210558	nonsense	probably null
gadfly	UTSW	2	155182298	nonsense	probably null
hankerin	UTSW	2	155210582	critical splice donor site	probably null
irresistable	UTSW	2	155203297	missense	probably benign	0.34
prurient	UTSW	2	155210502	missense	probably damaging	1.00
scratch	UTSW	2	155172561	missense	probably damaging	0.99
R0116:Itch	UTSW	2	155217983	splice site	probably benign
R0226:Itch	UTSW	2	155199394	missense	probably benign	0.01
R0545:Itch	UTSW	2	155182298	nonsense	probably null
R0689:Itch	UTSW	2	155182178	missense	possibly damaging	0.82
R1365:Itch	UTSW	2	155213031	missense	probably benign	0.00
R1406:Itch	UTSW	2	155206354	missense	possibly damaging	0.95
R1406:Itch	UTSW	2	155206354	missense	possibly damaging	0.95
R1436:Itch	UTSW	2	155192145	missense	probably damaging	0.96
R1639:Itch	UTSW	2	155179025	splice site	probably null
R1769:Itch	UTSW	2	155172561	missense	probably damaging	0.99
R1855:Itch	UTSW	2	155172454	splice site	probably benign
R1865:Itch	UTSW	2	155168746	missense	probably damaging	0.96
R2008:Itch	UTSW	2	155210459	missense	possibly damaging	0.91
R2054:Itch	UTSW	2	155210576	missense	probably damaging	1.00
R2196:Itch	UTSW	2	155202221	missense	probably benign
R2199:Itch	UTSW	2	155202221	missense	probably benign
R2252:Itch	UTSW	2	155212339	missense	probably benign	0.01
R2253:Itch	UTSW	2	155212339	missense	probably benign	0.01
R2348:Itch	UTSW	2	155209078	missense	possibly damaging	0.93
R2850:Itch	UTSW	2	155202221	missense	probably benign
R3021:Itch	UTSW	2	155209126	missense	possibly damaging	0.74
R4676:Itch	UTSW	2	155199435	missense	probably benign	0.05
R4716:Itch	UTSW	2	155210582	critical splice donor site	probably null
R4888:Itch	UTSW	2	155217977	splice site	probably null
R4970:Itch	UTSW	2	155185593	missense	possibly damaging	0.50
R6029:Itch	UTSW	2	155179089	critical splice donor site	probably null
R6122:Itch	UTSW	2	155174065	missense	probably benign	0.05
R6435:Itch	UTSW	2	155209129	missense	probably benign	0.01
R6449:Itch	UTSW	2	155163395	splice site	probably benign
R7069:Itch	UTSW	2	155209994	missense	probably damaging	1.00
R7083:Itch	UTSW	2	155210444	missense	probably damaging	1.00
R7409:Itch	UTSW	2	155199382	missense	probably damaging	0.99
R7689:Itch	UTSW	2	155210002	missense	probably damaging	0.99
R7689:Itch	UTSW	2	155213067	missense	probably benign	0.00
R7974:Itch	UTSW	2	155192159	missense	probably damaging	1.00
R8046:Itch	UTSW	2	155210502	missense	probably damaging	1.00
R8248:Itch	UTSW	2	155206383	critical splice donor site	probably null
R8355:Itch	UTSW	2	155210582	critical splice donor site	probably null
R8428:Itch	UTSW	2	155168707	missense	probably benign	0.38
R8691:Itch	UTSW	2	155210558	nonsense	probably null
R8779:Itch	UTSW	2	155172520	missense	probably benign	0.28
R9010:Itch	UTSW	2	155179071	missense	probably benign
R9130:Itch	UTSW	2	155210125	splice site	probably benign
R9278:Itch	UTSW	2	155203297	missense	probably benign	0.34
Z1177:Itch	UTSW	2	155209059	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTTCTTGGAAGCCCCTACAGCAC -3'
(R):5'- CTCTGGACAACCGAAGACATCGTTATC -3'

Sequencing Primer
(F):5'- aaaaaaaaaaaaaaaaaaGCACCCCC -3'
(R):5'- GACTGCTGTGTAACATCAGC -3'

Posted On

2013-05-09