Mutagenetix > Incidental Mutation

Incidental Mutation 'R4545:Hecw2'

333701

Institutional Source

Beutler Lab

Gene Symbol

Hecw2

Ensembl Gene

ENSMUSG00000042807

Gene Name

HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2

Synonyms

A730039N16Rik, Nedl2, D030049F17Rik

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.268) question?

Stock #

R4545 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

53806876-54195168 bp(-) (GRCm38)

Type of Mutation

makesense

DNA Base Change (assembly)

T to C at 53813222 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Stop codon to Tryptophan at position 1579 (*1579W)

Ref Sequence

ENSEMBL: ENSMUSP00000113283 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087659] [ENSMUST00000120904]

AlphaFold

Q6I6G8

Predicted Effect

probably null
Transcript: ENSMUST00000087659
AA Change: *1579W

SMART Domains

Protein: ENSMUSP00000084942
Gene: ENSMUSG00000042807
AA Change: *1579W

Domain	Start	End	E-Value	Type
Pfam:HECW_N	45	164	4.6e-62	PFAM
low complexity region	165	178	N/A	INTRINSIC
C2	186	297	2.19e-12	SMART
low complexity region	577	596	N/A	INTRINSIC
low complexity region	716	735	N/A	INTRINSIC
low complexity region	746	755	N/A	INTRINSIC
low complexity region	769	786	N/A	INTRINSIC
WW	814	846	1.21e-11	SMART
coiled coil region	853	880	N/A	INTRINSIC
low complexity region	913	925	N/A	INTRINSIC
WW	992	1024	2.12e-7	SMART
Blast:HECTc	1111	1183	2e-23	BLAST
HECTc	1241	1578	8.02e-183	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000120904
AA Change: *1579W

SMART Domains

Protein: ENSMUSP00000113283
Gene: ENSMUSG00000042807
AA Change: *1579W

Domain	Start	End	E-Value	Type
PDB:2LFE\|A	42	162	6e-80	PDB
low complexity region	165	178	N/A	INTRINSIC
C2	186	297	2.19e-12	SMART
low complexity region	577	596	N/A	INTRINSIC
low complexity region	716	735	N/A	INTRINSIC
low complexity region	746	755	N/A	INTRINSIC
low complexity region	769	786	N/A	INTRINSIC
WW	814	846	1.21e-11	SMART
coiled coil region	853	880	N/A	INTRINSIC
low complexity region	913	925	N/A	INTRINSIC
WW	992	1024	2.12e-7	SMART
Blast:HECTc	1111	1183	2e-23	BLAST
HECTc	1241	1578	8.02e-183	SMART

Meta Mutation Damage Score

0.8783

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

98% (41/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of E3 ubiquitin ligases which plays an important role in the proliferation, migration and differentiation of neural crest cells as a regulator of glial cell line-derived neurotrophic factor (GDNF)/Ret signaling. This gene also plays an important role in angiogenesis through stabilization of endothelial cell-to-cell junctions as a regulator of angiomotin-like 1 stability. The encoded protein contains an N-terminal calcium/lipid-binding (C2) domain involved in membrane targeting, two-four WW domains responsible for cellular localization and substrate recognition, and a C-terminal homologous with E6-associated protein C-terminus (HECT) catalytic domain. Naturally occurring mutations in this gene are associated with neurodevelopmental delay, hypotonia, and epilepsy. The decreased expression of this gene in the aganglionic colon is associated with Hirschsprung's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akr1c20	A	C	13: 4,507,844	V201G	probably damaging	Het
Atf7	A	G	15: 102,534,327	V449A	probably benign	Het
Ccr1	G	A	9: 123,964,400	A31V	probably benign	Het
Chrna6	A	T	8: 27,406,683	S389T	probably benign	Het
Clic6	C	T	16: 92,492,157		probably benign	Het
Cmya5	G	A	13: 93,091,918	R2221*	probably null	Het
Coq8b	G	T	7: 27,233,505	C13F	probably benign	Het
Cspg4	T	A	9: 56,888,629	L1216Q	possibly damaging	Het
Decr1	C	A	4: 15,930,979	V118F	probably damaging	Het
Dlec1	A	T	9: 119,128,078	I796F	probably damaging	Het
Dnajc11	T	A	4: 151,979,941	D516E	probably damaging	Het
Dock8	G	A	19: 25,188,358	V1869M	probably damaging	Het
Dst	A	G	1: 34,188,738	D1982G	probably damaging	Het
Gm11808	C	T	4: 3,973,244	R106H	probably benign	Het
Gnptab	G	A	10: 88,414,595	D190N	probably benign	Het
Golga4	A	G	9: 118,556,845	K22E	probably damaging	Het
Ica1l	A	G	1: 60,013,818		probably null	Het
Ift122	T	A	6: 115,890,588	L433Q	probably damaging	Het
Iqgap1	T	C	7: 80,762,567		probably null	Het
Klra13-ps	T	C	6: 130,291,269		noncoding transcript	Het
Mndal	A	T	1: 173,875,664	Y58*	probably null	Het
Mvb12b	G	C	2: 33,827,700	P172R	possibly damaging	Het
Ncapg	T	C	5: 45,671,212	F102L	probably damaging	Het
Olfr1447	T	A	19: 12,901,268	K171*	probably null	Het
Olfr235	T	C	19: 12,268,824	V198A	possibly damaging	Het
Olfr390	T	C	11: 73,787,166	V76A	probably damaging	Het
Pde8a	A	T	7: 81,328,099	R713S	probably damaging	Het
Rbks	T	C	5: 31,624,568	N296S	probably benign	Het
Sema3c	G	A	5: 17,694,772	V421I	probably benign	Het
Tm9sf1	A	G	14: 55,638,108	V393A	possibly damaging	Het
Tubgcp2	G	A	7: 139,996,071	P893L	possibly damaging	Het
Vnn3	G	A	10: 23,856,326	R158H	probably benign	Het
Zfa-ps	G	T	10: 52,544,936		noncoding transcript	Het
Zfp414	T	C	17: 33,631,648		probably benign	Het
Zfp810	G	A	9: 22,278,745	T289I	probably damaging	Het
Zfp819	G	T	7: 43,617,785	R488L	probably damaging	Het
Zfp942	C	T	17: 21,928,304	G448D	probably benign	Het
Zscan12	A	G	13: 21,366,705	K165E	possibly damaging	Het

Other mutations in Hecw2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Hecw2	APN	1	53830737	missense	probably damaging	1.00
IGL00338:Hecw2	APN	1	53827881	splice site	probably benign
IGL00530:Hecw2	APN	1	53853280	missense	probably damaging	1.00
IGL01343:Hecw2	APN	1	53826976	missense	probably damaging	0.96
IGL01503:Hecw2	APN	1	53826961	missense	probably damaging	1.00
IGL01989:Hecw2	APN	1	53840792	missense	probably damaging	1.00
IGL02016:Hecw2	APN	1	53831543	missense	possibly damaging	0.73
IGL02052:Hecw2	APN	1	53926511	missense	probably benign
IGL02085:Hecw2	APN	1	53942802	critical splice acceptor site	probably null
IGL02302:Hecw2	APN	1	53933248	missense	probably damaging	1.00
IGL02310:Hecw2	APN	1	53923916	missense	probably null	0.38
IGL02388:Hecw2	APN	1	53925699	missense	probably benign	0.17
IGL02499:Hecw2	APN	1	53926488	missense	probably benign
IGL02695:Hecw2	APN	1	53926209	missense	possibly damaging	0.94
IGL02732:Hecw2	APN	1	53926688	splice site	probably benign
IGL03100:Hecw2	APN	1	53831656	missense	probably damaging	1.00
IGL03175:Hecw2	APN	1	53926257	missense	possibly damaging	0.51
IGL03253:Hecw2	APN	1	53832716	missense	possibly damaging	0.85
IGL03356:Hecw2	APN	1	53927058	splice site	probably benign
Memoriam	UTSW	1	53926056	missense	probably benign
recollect	UTSW	1	53904422	missense	possibly damaging	0.88
ANU74:Hecw2	UTSW	1	53925694	missense	probably benign	0.01
R0077:Hecw2	UTSW	1	53868831	splice site	probably benign
R0133:Hecw2	UTSW	1	53830740	missense	probably damaging	1.00
R0268:Hecw2	UTSW	1	53926698	splice site	probably benign
R1303:Hecw2	UTSW	1	54040393	missense	probably benign	0.00
R1460:Hecw2	UTSW	1	53813245	missense	probably damaging	0.96
R1524:Hecw2	UTSW	1	53851618	missense	probably damaging	1.00
R1533:Hecw2	UTSW	1	53926545	splice site	probably null
R1828:Hecw2	UTSW	1	53926023	missense	probably benign
R2170:Hecw2	UTSW	1	53942797	missense	probably damaging	0.99
R2338:Hecw2	UTSW	1	53904422	missense	possibly damaging	0.88
R3016:Hecw2	UTSW	1	53830680	missense	probably damaging	1.00
R3872:Hecw2	UTSW	1	53832757	splice site	probably benign
R3892:Hecw2	UTSW	1	53926121	missense	probably benign	0.01
R4086:Hecw2	UTSW	1	53831656	missense	probably damaging	1.00
R4247:Hecw2	UTSW	1	53832645	missense	probably damaging	1.00
R4248:Hecw2	UTSW	1	53832645	missense	probably damaging	1.00
R4249:Hecw2	UTSW	1	53832645	missense	probably damaging	1.00
R4805:Hecw2	UTSW	1	53840859	missense	probably damaging	1.00
R4834:Hecw2	UTSW	1	53830752	missense	probably damaging	1.00
R4884:Hecw2	UTSW	1	53950841	missense	probably benign	0.03
R4983:Hecw2	UTSW	1	53832671	missense	probably benign	0.42
R5168:Hecw2	UTSW	1	53913300	missense	probably damaging	1.00
R5482:Hecw2	UTSW	1	53926201	missense	probably benign	0.09
R5549:Hecw2	UTSW	1	53925691	missense	possibly damaging	0.91
R5623:Hecw2	UTSW	1	53832623	missense	probably null	1.00
R5740:Hecw2	UTSW	1	53887603	missense	probably benign	0.12
R5919:Hecw2	UTSW	1	53937090	missense	probably damaging	0.99
R6058:Hecw2	UTSW	1	53923976	missense	possibly damaging	0.67
R6460:Hecw2	UTSW	1	53868833	splice site	probably null
R6875:Hecw2	UTSW	1	53937132	missense	probably benign	0.01
R7097:Hecw2	UTSW	1	53865124	missense	possibly damaging	0.88
R7131:Hecw2	UTSW	1	53865121	missense	probably damaging	1.00
R7291:Hecw2	UTSW	1	53914594	missense	probably damaging	1.00
R7401:Hecw2	UTSW	1	53904343	missense	probably damaging	1.00
R7482:Hecw2	UTSW	1	54040470	missense	probably damaging	0.99
R7501:Hecw2	UTSW	1	53913872	critical splice acceptor site	probably null
R7520:Hecw2	UTSW	1	53926056	missense	probably benign
R7611:Hecw2	UTSW	1	53913300	missense	probably damaging	1.00
R8184:Hecw2	UTSW	1	54040387	missense	probably benign	0.37
R8286:Hecw2	UTSW	1	53840769	missense	probably damaging	1.00
R8300:Hecw2	UTSW	1	53887616	missense	probably null	0.07
R8354:Hecw2	UTSW	1	53925308	critical splice donor site	probably null
R8362:Hecw2	UTSW	1	54040491	start codon destroyed	probably null	0.51
R8691:Hecw2	UTSW	1	53865064	missense	probably benign	0.26
R8745:Hecw2	UTSW	1	53933171	missense	probably damaging	1.00
R8769:Hecw2	UTSW	1	53913348	missense	probably benign	0.00
R8830:Hecw2	UTSW	1	53891146	missense	probably damaging	1.00
R8842:Hecw2	UTSW	1	53950874	missense
R8874:Hecw2	UTSW	1	53904449	splice site	probably benign
R9064:Hecw2	UTSW	1	53826886	missense	probably benign	0.08
R9326:Hecw2	UTSW	1	54040210	missense	probably damaging	1.00
R9450:Hecw2	UTSW	1	53839029	nonsense	probably null
R9486:Hecw2	UTSW	1	53813307	missense	probably damaging	1.00
R9763:Hecw2	UTSW	1	53923915	missense	probably damaging	1.00
R9766:Hecw2	UTSW	1	53865128	missense	probably damaging	1.00
Z1177:Hecw2	UTSW	1	53923943	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- ACTGAAAGACTGTTGGGTTGTTCC -3'
(R):5'- GCACAGGAGCATGGACTTTG -3'

Sequencing Primer
(F):5'- GGTTGTTCCATGGGCACC -3'
(R):5'- ACAGGAGCATGGACTTTGTTTGC -3'

Posted On

2015-08-18