Incidental Mutation 'R4545:Ica1l'
ID 333702
Institutional Source Beutler Lab
Gene Symbol Ica1l
Ensembl Gene ENSMUSG00000026018
Gene Name islet cell autoantigen 1-like
Synonyms 1700030B17Rik, Als2cr15
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4545 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 59982490-60043184 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 60013818 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027172] [ENSMUST00000189776] [ENSMUST00000191251]
AlphaFold Q3TY65
Predicted Effect probably null
Transcript: ENSMUST00000027172
SMART Domains Protein: ENSMUSP00000027172
Gene: ENSMUSG00000026018

DomainStartEndE-ValueType
Arfaptin 15 242 1.03e-112 SMART
ICA69 254 431 1.35e-75 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187364
Predicted Effect probably null
Transcript: ENSMUST00000189776
SMART Domains Protein: ENSMUSP00000141103
Gene: ENSMUSG00000026018

DomainStartEndE-ValueType
Arfaptin 15 242 7.8e-117 SMART
ICA69 254 439 2.7e-64 SMART
Predicted Effect probably null
Transcript: ENSMUST00000191251
SMART Domains Protein: ENSMUSP00000140520
Gene: ENSMUSG00000026018

DomainStartEndE-ValueType
Arfaptin 15 242 1.03e-112 SMART
ICA69 254 431 1.35e-75 SMART
Meta Mutation Damage Score 0.9750 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (41/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit reduced male fertility with oligospermia, globospermia, and abnormal spermiogenesis, sperm nucleus and mitochondrial sheath morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Atf7 A G 15: 102,534,327 V449A probably benign Het
Ccr1 G A 9: 123,964,400 A31V probably benign Het
Chrna6 A T 8: 27,406,683 S389T probably benign Het
Clic6 C T 16: 92,492,157 probably benign Het
Cmya5 G A 13: 93,091,918 R2221* probably null Het
Coq8b G T 7: 27,233,505 C13F probably benign Het
Cspg4 T A 9: 56,888,629 L1216Q possibly damaging Het
Decr1 C A 4: 15,930,979 V118F probably damaging Het
Dlec1 A T 9: 119,128,078 I796F probably damaging Het
Dnajc11 T A 4: 151,979,941 D516E probably damaging Het
Dock8 G A 19: 25,188,358 V1869M probably damaging Het
Dst A G 1: 34,188,738 D1982G probably damaging Het
Gm11808 C T 4: 3,973,244 R106H probably benign Het
Gnptab G A 10: 88,414,595 D190N probably benign Het
Golga4 A G 9: 118,556,845 K22E probably damaging Het
Hecw2 T C 1: 53,813,222 *1579W probably null Het
Ift122 T A 6: 115,890,588 L433Q probably damaging Het
Iqgap1 T C 7: 80,762,567 probably null Het
Klra13-ps T C 6: 130,291,269 noncoding transcript Het
Mndal A T 1: 173,875,664 Y58* probably null Het
Mvb12b G C 2: 33,827,700 P172R possibly damaging Het
Ncapg T C 5: 45,671,212 F102L probably damaging Het
Olfr1447 T A 19: 12,901,268 K171* probably null Het
Olfr235 T C 19: 12,268,824 V198A possibly damaging Het
Olfr390 T C 11: 73,787,166 V76A probably damaging Het
Pde8a A T 7: 81,328,099 R713S probably damaging Het
Rbks T C 5: 31,624,568 N296S probably benign Het
Sema3c G A 5: 17,694,772 V421I probably benign Het
Tm9sf1 A G 14: 55,638,108 V393A possibly damaging Het
Tubgcp2 G A 7: 139,996,071 P893L possibly damaging Het
Vnn3 G A 10: 23,856,326 R158H probably benign Het
Zfa-ps G T 10: 52,544,936 noncoding transcript Het
Zfp414 T C 17: 33,631,648 probably benign Het
Zfp810 G A 9: 22,278,745 T289I probably damaging Het
Zfp819 G T 7: 43,617,785 R488L probably damaging Het
Zfp942 C T 17: 21,928,304 G448D probably benign Het
Zscan12 A G 13: 21,366,705 K165E possibly damaging Het
Other mutations in Ica1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Ica1l APN 1 60013947 missense probably damaging 1.00
IGL01526:Ica1l APN 1 60015757 missense probably damaging 0.99
IGL02538:Ica1l APN 1 60010186 missense probably benign 0.01
IGL02966:Ica1l APN 1 60010139 missense probably damaging 1.00
IGL03379:Ica1l APN 1 59997621 missense probably benign 0.07
PIT4466001:Ica1l UTSW 1 60015836 critical splice acceptor site probably null
R0278:Ica1l UTSW 1 60013996 missense probably benign 0.05
R0780:Ica1l UTSW 1 59997449 critical splice donor site probably null
R0926:Ica1l UTSW 1 60006297 missense probably benign 0.09
R1834:Ica1l UTSW 1 60028236 utr 5 prime probably benign
R2402:Ica1l UTSW 1 60006292 missense probably benign 0.00
R4155:Ica1l UTSW 1 60013893 missense possibly damaging 0.71
R4754:Ica1l UTSW 1 60028162 missense probably damaging 1.00
R4791:Ica1l UTSW 1 60010201 missense probably damaging 1.00
R5096:Ica1l UTSW 1 60028154 missense possibly damaging 0.92
R5217:Ica1l UTSW 1 60015758 missense probably benign 0.03
R5461:Ica1l UTSW 1 60013851 missense probably damaging 1.00
R5780:Ica1l UTSW 1 60028215 missense probably benign 0.04
R6557:Ica1l UTSW 1 59997625 missense probably benign 0.28
R7400:Ica1l UTSW 1 60042642 splice site probably null
R7560:Ica1l UTSW 1 60010210 nonsense probably null
R7819:Ica1l UTSW 1 60015794 missense possibly damaging 0.79
R7824:Ica1l UTSW 1 60007870 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCATCTGCCGAAATATCCAAGC -3'
(R):5'- TCGTCTTAAGCAAGAAGTGGC -3'

Sequencing Primer
(F):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'
(R):5'- CAACATTCAGTCAGAGGGCCATTTC -3'
Posted On 2015-08-18