Incidental Mutation 'R4545:Mndal'
ID 333703
Institutional Source Beutler Lab
Gene Symbol Mndal
Ensembl Gene ENSMUSG00000090272
Gene Name myeloid nuclear differentiation antigen like
Synonyms Gm2785
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock # R4545 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 173849126-173942491 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 173875664 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 58 (Y58*)
Ref Sequence ENSEMBL: ENSMUSP00000140191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111210] [ENSMUST00000186442] [ENSMUST00000188804] [ENSMUST00000190071] [ENSMUST00000190651]
AlphaFold D0QMC3
Predicted Effect probably null
Transcript: ENSMUST00000111210
AA Change: Y58*
SMART Domains Protein: ENSMUSP00000106841
Gene: ENSMUSG00000090272
AA Change: Y58*

DomainStartEndE-ValueType
PYRIN 5 83 3.71e-20 SMART
internal_repeat_1 152 166 2.38e-7 PROSPERO
low complexity region 170 200 N/A INTRINSIC
internal_repeat_1 208 222 2.38e-7 PROSPERO
low complexity region 225 249 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
Pfam:HIN 311 479 3.4e-76 PFAM
low complexity region 497 507 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000186442
AA Change: Y58*
SMART Domains Protein: ENSMUSP00000140539
Gene: ENSMUSG00000090272
AA Change: Y58*

DomainStartEndE-ValueType
PYRIN 5 83 1.8e-24 SMART
internal_repeat_1 152 166 4.72e-7 PROSPERO
low complexity region 170 200 N/A INTRINSIC
internal_repeat_1 208 222 4.72e-7 PROSPERO
low complexity region 225 237 N/A INTRINSIC
low complexity region 239 250 N/A INTRINSIC
Pfam:HIN 258 427 2.9e-83 PFAM
low complexity region 444 454 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187636
Predicted Effect probably null
Transcript: ENSMUST00000188804
AA Change: Y58*
SMART Domains Protein: ENSMUSP00000140610
Gene: ENSMUSG00000090272
AA Change: Y58*

DomainStartEndE-ValueType
PYRIN 5 83 3.71e-20 SMART
internal_repeat_1 152 166 2.38e-7 PROSPERO
low complexity region 170 200 N/A INTRINSIC
internal_repeat_1 208 222 2.38e-7 PROSPERO
low complexity region 225 249 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
Pfam:HIN 311 480 4.3e-86 PFAM
low complexity region 497 507 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189501
Predicted Effect probably benign
Transcript: ENSMUST00000190071
SMART Domains Protein: ENSMUSP00000141055
Gene: ENSMUSG00000090272

DomainStartEndE-ValueType
internal_repeat_1 21 35 3.67e-8 PROSPERO
low complexity region 39 69 N/A INTRINSIC
internal_repeat_1 77 91 3.67e-8 PROSPERO
low complexity region 94 106 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000190651
AA Change: Y58*
SMART Domains Protein: ENSMUSP00000140191
Gene: ENSMUSG00000090272
AA Change: Y58*

DomainStartEndE-ValueType
PYRIN 5 83 1.8e-24 SMART
low complexity region 170 182 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191500
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Atf7 A G 15: 102,534,327 V449A probably benign Het
Ccr1 G A 9: 123,964,400 A31V probably benign Het
Chrna6 A T 8: 27,406,683 S389T probably benign Het
Clic6 C T 16: 92,492,157 probably benign Het
Cmya5 G A 13: 93,091,918 R2221* probably null Het
Coq8b G T 7: 27,233,505 C13F probably benign Het
Cspg4 T A 9: 56,888,629 L1216Q possibly damaging Het
Decr1 C A 4: 15,930,979 V118F probably damaging Het
Dlec1 A T 9: 119,128,078 I796F probably damaging Het
Dnajc11 T A 4: 151,979,941 D516E probably damaging Het
Dock8 G A 19: 25,188,358 V1869M probably damaging Het
Dst A G 1: 34,188,738 D1982G probably damaging Het
Gm11808 C T 4: 3,973,244 R106H probably benign Het
Gnptab G A 10: 88,414,595 D190N probably benign Het
Golga4 A G 9: 118,556,845 K22E probably damaging Het
Hecw2 T C 1: 53,813,222 *1579W probably null Het
Ica1l A G 1: 60,013,818 probably null Het
Ift122 T A 6: 115,890,588 L433Q probably damaging Het
Iqgap1 T C 7: 80,762,567 probably null Het
Klra13-ps T C 6: 130,291,269 noncoding transcript Het
Mvb12b G C 2: 33,827,700 P172R possibly damaging Het
Ncapg T C 5: 45,671,212 F102L probably damaging Het
Olfr1447 T A 19: 12,901,268 K171* probably null Het
Olfr235 T C 19: 12,268,824 V198A possibly damaging Het
Olfr390 T C 11: 73,787,166 V76A probably damaging Het
Pde8a A T 7: 81,328,099 R713S probably damaging Het
Rbks T C 5: 31,624,568 N296S probably benign Het
Sema3c G A 5: 17,694,772 V421I probably benign Het
Tm9sf1 A G 14: 55,638,108 V393A possibly damaging Het
Tubgcp2 G A 7: 139,996,071 P893L possibly damaging Het
Vnn3 G A 10: 23,856,326 R158H probably benign Het
Zfa-ps G T 10: 52,544,936 noncoding transcript Het
Zfp414 T C 17: 33,631,648 probably benign Het
Zfp810 G A 9: 22,278,745 T289I probably damaging Het
Zfp819 G T 7: 43,617,785 R488L probably damaging Het
Zfp942 C T 17: 21,928,304 G448D probably benign Het
Zscan12 A G 13: 21,366,705 K165E possibly damaging Het
Other mutations in Mndal
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Mndal APN 1 173857456 missense possibly damaging 0.68
IGL02309:Mndal APN 1 173874455 missense probably damaging 0.98
IGL02559:Mndal APN 1 173872920 missense probably benign 0.06
IGL02637:Mndal APN 1 173857437 missense possibly damaging 0.63
LCD18:Mndal UTSW 1 173880218 unclassified probably benign
R0076:Mndal UTSW 1 173874447 nonsense probably null
R0123:Mndal UTSW 1 173857513 splice site probably benign
R0134:Mndal UTSW 1 173857513 splice site probably benign
R0225:Mndal UTSW 1 173857513 splice site probably benign
R0976:Mndal UTSW 1 173862845 missense possibly damaging 0.70
R1081:Mndal UTSW 1 173860222 missense probably benign 0.01
R1497:Mndal UTSW 1 173872875 missense probably benign 0.04
R1522:Mndal UTSW 1 173871466 missense possibly damaging 0.68
R1630:Mndal UTSW 1 173874392 missense possibly damaging 0.52
R1874:Mndal UTSW 1 173860367 unclassified probably benign
R4183:Mndal UTSW 1 173875771 missense possibly damaging 0.95
R4544:Mndal UTSW 1 173875664 nonsense probably null
R4907:Mndal UTSW 1 173862690 missense probably damaging 0.99
R5066:Mndal UTSW 1 173875663 missense probably damaging 1.00
R5853:Mndal UTSW 1 173862504 missense probably damaging 0.98
R6208:Mndal UTSW 1 173857422 missense possibly damaging 0.84
R6395:Mndal UTSW 1 173871433 missense possibly damaging 0.73
R6923:Mndal UTSW 1 173884698 splice site probably null
R6933:Mndal UTSW 1 173875683 missense probably damaging 1.00
R7030:Mndal UTSW 1 173875594 missense probably damaging 1.00
R7327:Mndal UTSW 1 173875619 missense unknown
R7648:Mndal UTSW 1 173857395 missense probably benign 0.01
R8130:Mndal UTSW 1 173871545 nonsense probably null
R8514:Mndal UTSW 1 173860192 missense possibly damaging 0.84
R8697:Mndal UTSW 1 173872992 nonsense probably null
R9134:Mndal UTSW 1 173871530 missense unknown
R9257:Mndal UTSW 1 173862708 missense probably damaging 1.00
R9458:Mndal UTSW 1 173860183 missense probably damaging 1.00
Z1177:Mndal UTSW 1 173874404 missense unknown
Predicted Primers PCR Primer
(F):5'- GCATATCAGCTGTGATCACAC -3'
(R):5'- TGTTCACTCACATGAGAATATCCTG -3'

Sequencing Primer
(F):5'- TCACACAGGGAGTTAGCAAGTTTG -3'
(R):5'- CACTCACATGAGAATATCCTGTCTTG -3'
Posted On 2015-08-18