Incidental Mutation 'R4545:Mndal'
ID 333703
Institutional Source Beutler Lab
Gene Symbol Mndal
Ensembl Gene ENSMUSG00000090272
Gene Name myeloid nuclear differentiation antigen like
Synonyms Ifi212
Accession Numbers
Essential gene? Probably non essential (E-score: 0.101) question?
Stock # R4545 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 173684786-173708038 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 173703230 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 58 (Y58*)
Ref Sequence ENSEMBL: ENSMUSP00000140191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111210] [ENSMUST00000186442] [ENSMUST00000188804] [ENSMUST00000190071] [ENSMUST00000190651]
AlphaFold D0QMC3
Predicted Effect probably null
Transcript: ENSMUST00000111210
AA Change: Y58*
SMART Domains Protein: ENSMUSP00000106841
Gene: ENSMUSG00000090272
AA Change: Y58*

DomainStartEndE-ValueType
PYRIN 5 83 3.71e-20 SMART
internal_repeat_1 152 166 2.38e-7 PROSPERO
low complexity region 170 200 N/A INTRINSIC
internal_repeat_1 208 222 2.38e-7 PROSPERO
low complexity region 225 249 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
Pfam:HIN 311 479 3.4e-76 PFAM
low complexity region 497 507 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000186442
AA Change: Y58*
SMART Domains Protein: ENSMUSP00000140539
Gene: ENSMUSG00000090272
AA Change: Y58*

DomainStartEndE-ValueType
PYRIN 5 83 1.8e-24 SMART
internal_repeat_1 152 166 4.72e-7 PROSPERO
low complexity region 170 200 N/A INTRINSIC
internal_repeat_1 208 222 4.72e-7 PROSPERO
low complexity region 225 237 N/A INTRINSIC
low complexity region 239 250 N/A INTRINSIC
Pfam:HIN 258 427 2.9e-83 PFAM
low complexity region 444 454 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187636
Predicted Effect probably null
Transcript: ENSMUST00000188804
AA Change: Y58*
SMART Domains Protein: ENSMUSP00000140610
Gene: ENSMUSG00000090272
AA Change: Y58*

DomainStartEndE-ValueType
PYRIN 5 83 3.71e-20 SMART
internal_repeat_1 152 166 2.38e-7 PROSPERO
low complexity region 170 200 N/A INTRINSIC
internal_repeat_1 208 222 2.38e-7 PROSPERO
low complexity region 225 249 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
Pfam:HIN 311 480 4.3e-86 PFAM
low complexity region 497 507 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189501
Predicted Effect probably benign
Transcript: ENSMUST00000190071
SMART Domains Protein: ENSMUSP00000141055
Gene: ENSMUSG00000090272

DomainStartEndE-ValueType
internal_repeat_1 21 35 3.67e-8 PROSPERO
low complexity region 39 69 N/A INTRINSIC
internal_repeat_1 77 91 3.67e-8 PROSPERO
low complexity region 94 106 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000190651
AA Change: Y58*
SMART Domains Protein: ENSMUSP00000140191
Gene: ENSMUSG00000090272
AA Change: Y58*

DomainStartEndE-ValueType
PYRIN 5 83 1.8e-24 SMART
low complexity region 170 182 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191500
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 A C 13: 4,557,843 (GRCm39) V201G probably damaging Het
Atf7 A G 15: 102,442,762 (GRCm39) V449A probably benign Het
Ccr1 G A 9: 123,764,437 (GRCm39) A31V probably benign Het
Chrna6 A T 8: 27,896,711 (GRCm39) S389T probably benign Het
Clic6 C T 16: 92,289,045 (GRCm39) probably benign Het
Cmya5 G A 13: 93,228,426 (GRCm39) R2221* probably null Het
Coq8b G T 7: 26,932,930 (GRCm39) C13F probably benign Het
Cspg4 T A 9: 56,795,913 (GRCm39) L1216Q possibly damaging Het
Decr1 C A 4: 15,930,979 (GRCm39) V118F probably damaging Het
Dlec1 A T 9: 118,957,146 (GRCm39) I796F probably damaging Het
Dnajc11 T A 4: 152,064,398 (GRCm39) D516E probably damaging Het
Dock8 G A 19: 25,165,722 (GRCm39) V1869M probably damaging Het
Dst A G 1: 34,227,819 (GRCm39) D1982G probably damaging Het
Gnptab G A 10: 88,250,457 (GRCm39) D190N probably benign Het
Golga4 A G 9: 118,385,913 (GRCm39) K22E probably damaging Het
Hecw2 T C 1: 53,852,381 (GRCm39) *1579W probably null Het
Ica1l A G 1: 60,052,977 (GRCm39) probably null Het
Ift122 T A 6: 115,867,549 (GRCm39) L433Q probably damaging Het
Iqgap1 T C 7: 80,412,315 (GRCm39) probably null Het
Klra13-ps T C 6: 130,268,232 (GRCm39) noncoding transcript Het
Mvb12b G C 2: 33,717,712 (GRCm39) P172R possibly damaging Het
Ncapg T C 5: 45,828,554 (GRCm39) F102L probably damaging Het
Or1e30 T C 11: 73,677,992 (GRCm39) V76A probably damaging Het
Or5an11 T C 19: 12,246,188 (GRCm39) V198A possibly damaging Het
Or5b97 T A 19: 12,878,632 (GRCm39) K171* probably null Het
Pde8a A T 7: 80,977,847 (GRCm39) R713S probably damaging Het
Rbks T C 5: 31,781,912 (GRCm39) N296S probably benign Het
Sema3c G A 5: 17,899,770 (GRCm39) V421I probably benign Het
Tm9sf1 A G 14: 55,875,565 (GRCm39) V393A possibly damaging Het
Tubgcp2 G A 7: 139,575,984 (GRCm39) P893L possibly damaging Het
Uba52rt C T 4: 3,973,244 (GRCm39) R106H probably benign Het
Vnn3 G A 10: 23,732,224 (GRCm39) R158H probably benign Het
Zfa-ps G T 10: 52,421,032 (GRCm39) noncoding transcript Het
Zfp414 T C 17: 33,850,622 (GRCm39) probably benign Het
Zfp810 G A 9: 22,190,041 (GRCm39) T289I probably damaging Het
Zfp819 G T 7: 43,267,209 (GRCm39) R488L probably damaging Het
Zfp942 C T 17: 22,147,285 (GRCm39) G448D probably benign Het
Zscan12 A G 13: 21,550,875 (GRCm39) K165E possibly damaging Het
Other mutations in Mndal
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Mndal APN 1 173,685,022 (GRCm39) missense possibly damaging 0.68
IGL02309:Mndal APN 1 173,702,021 (GRCm39) missense probably damaging 0.98
IGL02559:Mndal APN 1 173,700,486 (GRCm39) missense probably benign 0.06
IGL02637:Mndal APN 1 173,685,003 (GRCm39) missense possibly damaging 0.63
LCD18:Mndal UTSW 1 173,707,784 (GRCm39) unclassified probably benign
R0076:Mndal UTSW 1 173,702,013 (GRCm39) nonsense probably null
R0123:Mndal UTSW 1 173,685,079 (GRCm39) splice site probably benign
R0134:Mndal UTSW 1 173,685,079 (GRCm39) splice site probably benign
R0225:Mndal UTSW 1 173,685,079 (GRCm39) splice site probably benign
R0976:Mndal UTSW 1 173,690,411 (GRCm39) missense possibly damaging 0.70
R1081:Mndal UTSW 1 173,687,788 (GRCm39) missense probably benign 0.01
R1497:Mndal UTSW 1 173,700,441 (GRCm39) missense probably benign 0.04
R1522:Mndal UTSW 1 173,699,032 (GRCm39) missense possibly damaging 0.68
R1630:Mndal UTSW 1 173,701,958 (GRCm39) missense possibly damaging 0.52
R1874:Mndal UTSW 1 173,687,933 (GRCm39) unclassified probably benign
R4183:Mndal UTSW 1 173,703,337 (GRCm39) missense possibly damaging 0.95
R4544:Mndal UTSW 1 173,703,230 (GRCm39) nonsense probably null
R4907:Mndal UTSW 1 173,690,256 (GRCm39) missense probably damaging 0.99
R5066:Mndal UTSW 1 173,703,229 (GRCm39) missense probably damaging 1.00
R5853:Mndal UTSW 1 173,690,070 (GRCm39) missense probably damaging 0.98
R6208:Mndal UTSW 1 173,684,988 (GRCm39) missense possibly damaging 0.84
R6395:Mndal UTSW 1 173,698,999 (GRCm39) missense possibly damaging 0.73
R6923:Mndal UTSW 1 173,712,264 (GRCm39) splice site probably null
R6933:Mndal UTSW 1 173,703,249 (GRCm39) missense probably damaging 1.00
R7030:Mndal UTSW 1 173,703,160 (GRCm39) missense probably damaging 1.00
R7327:Mndal UTSW 1 173,703,185 (GRCm39) missense unknown
R7648:Mndal UTSW 1 173,684,961 (GRCm39) missense probably benign 0.01
R8130:Mndal UTSW 1 173,699,111 (GRCm39) nonsense probably null
R8514:Mndal UTSW 1 173,687,758 (GRCm39) missense possibly damaging 0.84
R8697:Mndal UTSW 1 173,700,558 (GRCm39) nonsense probably null
R9134:Mndal UTSW 1 173,699,096 (GRCm39) missense unknown
R9257:Mndal UTSW 1 173,690,274 (GRCm39) missense probably damaging 1.00
R9458:Mndal UTSW 1 173,687,749 (GRCm39) missense probably damaging 1.00
Z1177:Mndal UTSW 1 173,701,970 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GCATATCAGCTGTGATCACAC -3'
(R):5'- TGTTCACTCACATGAGAATATCCTG -3'

Sequencing Primer
(F):5'- TCACACAGGGAGTTAGCAAGTTTG -3'
(R):5'- CACTCACATGAGAATATCCTGTCTTG -3'
Posted On 2015-08-18