Mutagenetix > Incidental Mutations

Incidental Mutation 'R4545:Mndal'

333703

Institutional Source

Beutler Lab

Gene Symbol

Mndal

Ensembl Gene

ENSMUSG00000090272

Gene Name

myeloid nuclear differentiation antigen like

Synonyms

Gm2785

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.105) question?

Stock #

R4545 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

173849126-173942491 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 173875664 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 58 (Y58*)

Ref Sequence

ENSEMBL: ENSMUSP00000140191 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111210] [ENSMUST00000186442] [ENSMUST00000188804] [ENSMUST00000190071] [ENSMUST00000190651]

Predicted Effect

probably null
Transcript: ENSMUST00000111210
AA Change: Y58*

SMART Domains

Protein: ENSMUSP00000106841
Gene: ENSMUSG00000090272
AA Change: Y58*

Domain	Start	End	E-Value	Type
PYRIN	5	83	3.71e-20	SMART
internal_repeat_1	152	166	2.38e-7	PROSPERO
low complexity region	170	200	N/A	INTRINSIC
internal_repeat_1	208	222	2.38e-7	PROSPERO
low complexity region	225	249	N/A	INTRINSIC
low complexity region	276	292	N/A	INTRINSIC
low complexity region	294	305	N/A	INTRINSIC
Pfam:HIN	311	479	3.4e-76	PFAM
low complexity region	497	507	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000186442
AA Change: Y58*

SMART Domains

Protein: ENSMUSP00000140539
Gene: ENSMUSG00000090272
AA Change: Y58*

Domain	Start	End	E-Value	Type
PYRIN	5	83	1.8e-24	SMART
internal_repeat_1	152	166	4.72e-7	PROSPERO
low complexity region	170	200	N/A	INTRINSIC
internal_repeat_1	208	222	4.72e-7	PROSPERO
low complexity region	225	237	N/A	INTRINSIC
low complexity region	239	250	N/A	INTRINSIC
Pfam:HIN	258	427	2.9e-83	PFAM
low complexity region	444	454	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187636

Predicted Effect

probably null
Transcript: ENSMUST00000188804
AA Change: Y58*

SMART Domains

Protein: ENSMUSP00000140610
Gene: ENSMUSG00000090272
AA Change: Y58*

Domain	Start	End	E-Value	Type
PYRIN	5	83	3.71e-20	SMART
internal_repeat_1	152	166	2.38e-7	PROSPERO
low complexity region	170	200	N/A	INTRINSIC
internal_repeat_1	208	222	2.38e-7	PROSPERO
low complexity region	225	249	N/A	INTRINSIC
low complexity region	276	292	N/A	INTRINSIC
low complexity region	294	305	N/A	INTRINSIC
Pfam:HIN	311	480	4.3e-86	PFAM
low complexity region	497	507	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189501

Predicted Effect

probably benign
Transcript: ENSMUST00000190071

SMART Domains

Protein: ENSMUSP00000141055
Gene: ENSMUSG00000090272

Domain	Start	End	E-Value	Type
internal_repeat_1	21	35	3.67e-8	PROSPERO
low complexity region	39	69	N/A	INTRINSIC
internal_repeat_1	77	91	3.67e-8	PROSPERO
low complexity region	94	106	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000190651
AA Change: Y58*

SMART Domains

Protein: ENSMUSP00000140191
Gene: ENSMUSG00000090272
AA Change: Y58*

Domain	Start	End	E-Value	Type
PYRIN	5	83	1.8e-24	SMART
low complexity region	170	182	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191500

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

98% (41/42)

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akr1c20	A	C	13: 4,507,844	V201G	probably damaging	Het
Atf7	A	G	15: 102,534,327	V449A	probably benign	Het
Ccr1	G	A	9: 123,964,400	A31V	probably benign	Het
Chrna6	A	T	8: 27,406,683	S389T	probably benign	Het
Clic6	C	T	16: 92,492,157		probably benign	Het
Cmya5	G	A	13: 93,091,918	R2221*	probably null	Het
Coq8b	G	T	7: 27,233,505	C13F	probably benign	Het
Cspg4	T	A	9: 56,888,629	L1216Q	possibly damaging	Het
Decr1	C	A	4: 15,930,979	V118F	probably damaging	Het
Dlec1	A	T	9: 119,128,078	I796F	probably damaging	Het
Dnajc11	T	A	4: 151,979,941	D516E	probably damaging	Het
Dock8	G	A	19: 25,188,358	V1869M	probably damaging	Het
Dst	A	G	1: 34,188,738	D1982G	probably damaging	Het
Gm11808	C	T	4: 3,973,244	R106H	probably benign	Het
Gnptab	G	A	10: 88,414,595	D190N	probably benign	Het
Golga4	A	G	9: 118,556,845	K22E	probably damaging	Het
Hecw2	T	C	1: 53,813,222	*1579W	probably null	Het
Ica1l	A	G	1: 60,013,818		probably null	Het
Ift122	T	A	6: 115,890,588	L433Q	probably damaging	Het
Iqgap1	T	C	7: 80,762,567		probably null	Het
Klra13-ps	T	C	6: 130,291,269		noncoding transcript	Het
Mvb12b	G	C	2: 33,827,700	P172R	possibly damaging	Het
Ncapg	T	C	5: 45,671,212	F102L	probably damaging	Het
Olfr1447	T	A	19: 12,901,268	K171*	probably null	Het
Olfr235	T	C	19: 12,268,824	V198A	possibly damaging	Het
Olfr390	T	C	11: 73,787,166	V76A	probably damaging	Het
Pde8a	A	T	7: 81,328,099	R713S	probably damaging	Het
Rbks	T	C	5: 31,624,568	N296S	probably benign	Het
Sema3c	G	A	5: 17,694,772	V421I	probably benign	Het
Tm9sf1	A	G	14: 55,638,108	V393A	possibly damaging	Het
Tubgcp2	G	A	7: 139,996,071	P893L	possibly damaging	Het
Vnn3	G	A	10: 23,856,326	R158H	probably benign	Het
Zfa-ps	G	T	10: 52,544,936		noncoding transcript	Het
Zfp414	T	C	17: 33,631,648		probably benign	Het
Zfp810	G	A	9: 22,278,745	T289I	probably damaging	Het
Zfp819	G	T	7: 43,617,785	R488L	probably damaging	Het
Zfp942	C	T	17: 21,928,304	G448D	probably benign	Het
Zscan12	A	G	13: 21,366,705	K165E	possibly damaging	Het

Other mutations in Mndal

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01363:Mndal	APN	1	173857456	missense	possibly damaging	0.68
IGL02309:Mndal	APN	1	173874455	missense	probably damaging	0.98
IGL02559:Mndal	APN	1	173872920	missense	probably benign	0.06
IGL02637:Mndal	APN	1	173857437	missense	possibly damaging	0.63
LCD18:Mndal	UTSW	1	173880218	unclassified	probably benign
R0076:Mndal	UTSW	1	173874447	nonsense	probably null
R0123:Mndal	UTSW	1	173857513	splice site	probably benign
R0134:Mndal	UTSW	1	173857513	splice site	probably benign
R0225:Mndal	UTSW	1	173857513	splice site	probably benign
R0976:Mndal	UTSW	1	173862845	missense	possibly damaging	0.70
R1081:Mndal	UTSW	1	173860222	missense	probably benign	0.01
R1497:Mndal	UTSW	1	173872875	missense	probably benign	0.04
R1522:Mndal	UTSW	1	173871466	missense	possibly damaging	0.68
R1630:Mndal	UTSW	1	173874392	missense	possibly damaging	0.52
R1874:Mndal	UTSW	1	173860367	unclassified	probably benign
R4183:Mndal	UTSW	1	173875771	missense	possibly damaging	0.95
R4544:Mndal	UTSW	1	173875664	nonsense	probably null
R4907:Mndal	UTSW	1	173862690	missense	probably damaging	0.99
R5066:Mndal	UTSW	1	173875663	missense	probably damaging	1.00
R5853:Mndal	UTSW	1	173862504	missense	probably damaging	0.98
R6208:Mndal	UTSW	1	173857422	missense	possibly damaging	0.84
R6395:Mndal	UTSW	1	173871433	missense	possibly damaging	0.73
R6923:Mndal	UTSW	1	173884698	splice site	probably null
R6933:Mndal	UTSW	1	173875683	missense	probably damaging	1.00
R7030:Mndal	UTSW	1	173875594	missense	probably damaging	1.00
R7327:Mndal	UTSW	1	173875619	missense	unknown
R7648:Mndal	UTSW	1	173857395	missense	probably benign	0.01
R8130:Mndal	UTSW	1	173871545	nonsense	probably null
Z1177:Mndal	UTSW	1	173874404	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GCATATCAGCTGTGATCACAC -3'
(R):5'- TGTTCACTCACATGAGAATATCCTG -3'

Sequencing Primer
(F):5'- TCACACAGGGAGTTAGCAAGTTTG -3'
(R):5'- CACTCACATGAGAATATCCTGTCTTG -3'

Posted On

2015-08-18