Incidental Mutation 'R4545:Mvb12b'
ID 333704
Institutional Source Beutler Lab
Gene Symbol Mvb12b
Ensembl Gene ENSMUSG00000038740
Gene Name multivesicular body subunit 12B
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.883) question?
Stock # R4545 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 33729953-33887946 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 33827700 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Arginine at position 172 (P172R)
Ref Sequence ENSEMBL: ENSMUSP00000048901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041555] [ENSMUST00000148660]
AlphaFold Q6KAU4
Predicted Effect possibly damaging
Transcript: ENSMUST00000041555
AA Change: P172R

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000048901
Gene: ENSMUSG00000038740
AA Change: P172R

DomainStartEndE-ValueType
low complexity region 13 22 N/A INTRINSIC
Pfam:DUF2464 46 297 1.7e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148660
AA Change: P143R

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000115744
Gene: ENSMUSG00000038740
AA Change: P143R

DomainStartEndE-ValueType
Pfam:DUF2464 17 189 1.4e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192765
Meta Mutation Damage Score 0.2998 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the ESCRT-I complex, a heterotetramer, which mediates the sorting of ubiquitinated cargo protein from the plasma membrane to the endosomal vesicle. ESCRT-I complex plays an essential role in HIV budding and endosomal protein sorting. Depletion and overexpression of this and related protein (MVB12A) inhibit HIV-1 infectivity and induce unusual viral assembly defects, indicating a role for MVB12 subunits in regulating ESCRT-mediated virus budding. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Atf7 A G 15: 102,534,327 V449A probably benign Het
Ccr1 G A 9: 123,964,400 A31V probably benign Het
Chrna6 A T 8: 27,406,683 S389T probably benign Het
Clic6 C T 16: 92,492,157 probably benign Het
Cmya5 G A 13: 93,091,918 R2221* probably null Het
Coq8b G T 7: 27,233,505 C13F probably benign Het
Cspg4 T A 9: 56,888,629 L1216Q possibly damaging Het
Decr1 C A 4: 15,930,979 V118F probably damaging Het
Dlec1 A T 9: 119,128,078 I796F probably damaging Het
Dnajc11 T A 4: 151,979,941 D516E probably damaging Het
Dock8 G A 19: 25,188,358 V1869M probably damaging Het
Dst A G 1: 34,188,738 D1982G probably damaging Het
Gm11808 C T 4: 3,973,244 R106H probably benign Het
Gnptab G A 10: 88,414,595 D190N probably benign Het
Golga4 A G 9: 118,556,845 K22E probably damaging Het
Hecw2 T C 1: 53,813,222 *1579W probably null Het
Ica1l A G 1: 60,013,818 probably null Het
Ift122 T A 6: 115,890,588 L433Q probably damaging Het
Iqgap1 T C 7: 80,762,567 probably null Het
Klra13-ps T C 6: 130,291,269 noncoding transcript Het
Mndal A T 1: 173,875,664 Y58* probably null Het
Ncapg T C 5: 45,671,212 F102L probably damaging Het
Olfr1447 T A 19: 12,901,268 K171* probably null Het
Olfr235 T C 19: 12,268,824 V198A possibly damaging Het
Olfr390 T C 11: 73,787,166 V76A probably damaging Het
Pde8a A T 7: 81,328,099 R713S probably damaging Het
Rbks T C 5: 31,624,568 N296S probably benign Het
Sema3c G A 5: 17,694,772 V421I probably benign Het
Tm9sf1 A G 14: 55,638,108 V393A possibly damaging Het
Tubgcp2 G A 7: 139,996,071 P893L possibly damaging Het
Vnn3 G A 10: 23,856,326 R158H probably benign Het
Zfa-ps G T 10: 52,544,936 noncoding transcript Het
Zfp414 T C 17: 33,631,648 probably benign Het
Zfp810 G A 9: 22,278,745 T289I probably damaging Het
Zfp819 G T 7: 43,617,785 R488L probably damaging Het
Zfp942 C T 17: 21,928,304 G448D probably benign Het
Zscan12 A G 13: 21,366,705 K165E possibly damaging Het
Other mutations in Mvb12b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02429:Mvb12b APN 2 33827788 missense probably damaging 1.00
IGL02493:Mvb12b APN 2 33840209 missense probably benign 0.05
R1845:Mvb12b UTSW 2 33840157 critical splice donor site probably null
R2225:Mvb12b UTSW 2 33840199 missense possibly damaging 0.88
R5631:Mvb12b UTSW 2 33827703 missense probably damaging 1.00
R5733:Mvb12b UTSW 2 33827716 missense probably benign 0.02
R6043:Mvb12b UTSW 2 33874390 missense probably damaging 1.00
R6386:Mvb12b UTSW 2 33827742 missense probably damaging 1.00
R6563:Mvb12b UTSW 2 33825116 missense probably benign 0.04
R8160:Mvb12b UTSW 2 33840222 missense probably benign 0.44
Z1176:Mvb12b UTSW 2 33874370 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCAGTGTAAGCTGACGTAG -3'
(R):5'- CTTAGTCCCTCTGCCAAGTG -3'

Sequencing Primer
(F):5'- CTGACGTAGGCTGAGGTAGAGTC -3'
(R):5'- TTCTGCAGCACTGAAGGG -3'
Posted On 2015-08-18