Incidental Mutation 'R4545:Decr1'
ID 333707
Institutional Source Beutler Lab
Gene Symbol Decr1
Ensembl Gene ENSMUSG00000028223
Gene Name 2,4-dienoyl CoA reductase 1, mitochondrial
Synonyms Nadph, 1200012F07Rik, Decr
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.684) question?
Stock # R4545 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 15917240-15945507 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 15930979 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 118 (V118F)
Ref Sequence ENSEMBL: ENSMUSP00000029877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029877]
AlphaFold Q9CQ62
Predicted Effect probably damaging
Transcript: ENSMUST00000029877
AA Change: V118F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029877
Gene: ENSMUSG00000028223
AA Change: V118F

DomainStartEndE-ValueType
Pfam:adh_short 60 253 7.7e-34 PFAM
Pfam:KR 61 182 4.3e-9 PFAM
Pfam:adh_short_C2 66 304 2e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150464
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an accessory enzyme which participates in the beta-oxidation and metabolism of unsaturated fatty enoyl-CoA esters. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased sensitivity to fasting and cold stresses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Atf7 A G 15: 102,534,327 V449A probably benign Het
Ccr1 G A 9: 123,964,400 A31V probably benign Het
Chrna6 A T 8: 27,406,683 S389T probably benign Het
Clic6 C T 16: 92,492,157 probably benign Het
Cmya5 G A 13: 93,091,918 R2221* probably null Het
Coq8b G T 7: 27,233,505 C13F probably benign Het
Cspg4 T A 9: 56,888,629 L1216Q possibly damaging Het
Dlec1 A T 9: 119,128,078 I796F probably damaging Het
Dnajc11 T A 4: 151,979,941 D516E probably damaging Het
Dock8 G A 19: 25,188,358 V1869M probably damaging Het
Dst A G 1: 34,188,738 D1982G probably damaging Het
Gm11808 C T 4: 3,973,244 R106H probably benign Het
Gnptab G A 10: 88,414,595 D190N probably benign Het
Golga4 A G 9: 118,556,845 K22E probably damaging Het
Hecw2 T C 1: 53,813,222 *1579W probably null Het
Ica1l A G 1: 60,013,818 probably null Het
Ift122 T A 6: 115,890,588 L433Q probably damaging Het
Iqgap1 T C 7: 80,762,567 probably null Het
Klra13-ps T C 6: 130,291,269 noncoding transcript Het
Mndal A T 1: 173,875,664 Y58* probably null Het
Mvb12b G C 2: 33,827,700 P172R possibly damaging Het
Ncapg T C 5: 45,671,212 F102L probably damaging Het
Olfr1447 T A 19: 12,901,268 K171* probably null Het
Olfr235 T C 19: 12,268,824 V198A possibly damaging Het
Olfr390 T C 11: 73,787,166 V76A probably damaging Het
Pde8a A T 7: 81,328,099 R713S probably damaging Het
Rbks T C 5: 31,624,568 N296S probably benign Het
Sema3c G A 5: 17,694,772 V421I probably benign Het
Tm9sf1 A G 14: 55,638,108 V393A possibly damaging Het
Tubgcp2 G A 7: 139,996,071 P893L possibly damaging Het
Vnn3 G A 10: 23,856,326 R158H probably benign Het
Zfa-ps G T 10: 52,544,936 noncoding transcript Het
Zfp414 T C 17: 33,631,648 probably benign Het
Zfp810 G A 9: 22,278,745 T289I probably damaging Het
Zfp819 G T 7: 43,617,785 R488L probably damaging Het
Zfp942 C T 17: 21,928,304 G448D probably benign Het
Zscan12 A G 13: 21,366,705 K165E possibly damaging Het
Other mutations in Decr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Decr1 APN 4 15933056 missense probably benign 0.23
IGL02736:Decr1 APN 4 15930952 missense probably benign 0.01
IGL03141:Decr1 APN 4 15932902 missense probably damaging 1.00
I1329:Decr1 UTSW 4 15930976 nonsense probably null
R0472:Decr1 UTSW 4 15919849 missense probably damaging 1.00
R1295:Decr1 UTSW 4 15919207 missense possibly damaging 0.93
R1898:Decr1 UTSW 4 15929801 missense probably damaging 1.00
R1955:Decr1 UTSW 4 15924256 missense probably benign 0.09
R3160:Decr1 UTSW 4 15930972 missense probably damaging 0.99
R3162:Decr1 UTSW 4 15930972 missense probably damaging 0.99
R3162:Decr1 UTSW 4 15930972 missense probably damaging 0.99
R4962:Decr1 UTSW 4 15930976 nonsense probably null
R5188:Decr1 UTSW 4 15924270 missense probably damaging 1.00
R5190:Decr1 UTSW 4 15924270 missense probably damaging 1.00
R5215:Decr1 UTSW 4 15929795 missense probably damaging 1.00
R5556:Decr1 UTSW 4 15919244 missense probably damaging 1.00
R6164:Decr1 UTSW 4 15924347 missense probably benign 0.32
R6253:Decr1 UTSW 4 15931179 missense probably benign 0.00
R6313:Decr1 UTSW 4 15924261 missense probably benign 0.00
R6830:Decr1 UTSW 4 15924355 critical splice acceptor site probably null
R6998:Decr1 UTSW 4 15930960 missense probably damaging 1.00
R7064:Decr1 UTSW 4 15945392
R8052:Decr1 UTSW 4 15933019 missense probably benign 0.00
R8698:Decr1 UTSW 4 15922483 critical splice donor site probably null
R8806:Decr1 UTSW 4 15945351 start codon destroyed probably benign 0.01
R9217:Decr1 UTSW 4 15930969 missense probably damaging 1.00
X0026:Decr1 UTSW 4 15919846 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCTTTGCTTTAAACAGAGCCGG -3'
(R):5'- TGTTTTGAAAGCGACTGCAGAAG -3'

Sequencing Primer
(F):5'- TAAACAGAGCCGGCTTTTCC -3'
(R):5'- TTGAAAGCGACTGCAGAAGAGATTTC -3'
Posted On 2015-08-18