Incidental Mutation 'R4545:Dnajc11'
ID 333709
Institutional Source Beutler Lab
Gene Symbol Dnajc11
Ensembl Gene ENSMUSG00000039768
Gene Name DnaJ heat shock protein family (Hsp40) member C11
Synonyms E030019A03Rik
Accession Numbers
Essential gene? Probably essential (E-score: 0.962) question?
Stock # R4545 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 152018177-152066416 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 152064398 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 516 (D516E)
Ref Sequence ENSEMBL: ENSMUSP00000051643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036680] [ENSMUST00000062904] [ENSMUST00000105665] [ENSMUST00000139069]
AlphaFold Q5U458
Predicted Effect probably benign
Transcript: ENSMUST00000036680
SMART Domains Protein: ENSMUSP00000035240
Gene: ENSMUSG00000039759

DomainStartEndE-ValueType
THAP 3 88 5.28e-19 SMART
DM3 23 87 6.96e-21 SMART
coiled coil region 166 189 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000062904
AA Change: D516E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051643
Gene: ENSMUSG00000039768
AA Change: D516E

DomainStartEndE-ValueType
DnaJ 13 74 4.41e-24 SMART
low complexity region 102 122 N/A INTRINSIC
Pfam:DUF3395 410 549 2e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105665
SMART Domains Protein: ENSMUSP00000101290
Gene: ENSMUSG00000039759

DomainStartEndE-ValueType
THAP 3 88 5.28e-19 SMART
DM3 23 87 6.96e-21 SMART
coiled coil region 132 155 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128582
Predicted Effect probably benign
Transcript: ENSMUST00000139069
SMART Domains Protein: ENSMUSP00000119604
Gene: ENSMUSG00000039768

DomainStartEndE-ValueType
DnaJ 13 74 4.41e-24 SMART
low complexity region 102 122 N/A INTRINSIC
coiled coil region 318 349 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139555
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148048
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149337
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (41/42)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU mutation exhibit motor neuron pathology, disorganized cristae and lymphoid abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 A C 13: 4,557,843 (GRCm39) V201G probably damaging Het
Atf7 A G 15: 102,442,762 (GRCm39) V449A probably benign Het
Ccr1 G A 9: 123,764,437 (GRCm39) A31V probably benign Het
Chrna6 A T 8: 27,896,711 (GRCm39) S389T probably benign Het
Clic6 C T 16: 92,289,045 (GRCm39) probably benign Het
Cmya5 G A 13: 93,228,426 (GRCm39) R2221* probably null Het
Coq8b G T 7: 26,932,930 (GRCm39) C13F probably benign Het
Cspg4 T A 9: 56,795,913 (GRCm39) L1216Q possibly damaging Het
Decr1 C A 4: 15,930,979 (GRCm39) V118F probably damaging Het
Dlec1 A T 9: 118,957,146 (GRCm39) I796F probably damaging Het
Dock8 G A 19: 25,165,722 (GRCm39) V1869M probably damaging Het
Dst A G 1: 34,227,819 (GRCm39) D1982G probably damaging Het
Gnptab G A 10: 88,250,457 (GRCm39) D190N probably benign Het
Golga4 A G 9: 118,385,913 (GRCm39) K22E probably damaging Het
Hecw2 T C 1: 53,852,381 (GRCm39) *1579W probably null Het
Ica1l A G 1: 60,052,977 (GRCm39) probably null Het
Ift122 T A 6: 115,867,549 (GRCm39) L433Q probably damaging Het
Iqgap1 T C 7: 80,412,315 (GRCm39) probably null Het
Klra13-ps T C 6: 130,268,232 (GRCm39) noncoding transcript Het
Mndal A T 1: 173,703,230 (GRCm39) Y58* probably null Het
Mvb12b G C 2: 33,717,712 (GRCm39) P172R possibly damaging Het
Ncapg T C 5: 45,828,554 (GRCm39) F102L probably damaging Het
Or1e30 T C 11: 73,677,992 (GRCm39) V76A probably damaging Het
Or5an11 T C 19: 12,246,188 (GRCm39) V198A possibly damaging Het
Or5b97 T A 19: 12,878,632 (GRCm39) K171* probably null Het
Pde8a A T 7: 80,977,847 (GRCm39) R713S probably damaging Het
Rbks T C 5: 31,781,912 (GRCm39) N296S probably benign Het
Sema3c G A 5: 17,899,770 (GRCm39) V421I probably benign Het
Tm9sf1 A G 14: 55,875,565 (GRCm39) V393A possibly damaging Het
Tubgcp2 G A 7: 139,575,984 (GRCm39) P893L possibly damaging Het
Uba52rt C T 4: 3,973,244 (GRCm39) R106H probably benign Het
Vnn3 G A 10: 23,732,224 (GRCm39) R158H probably benign Het
Zfa-ps G T 10: 52,421,032 (GRCm39) noncoding transcript Het
Zfp414 T C 17: 33,850,622 (GRCm39) probably benign Het
Zfp810 G A 9: 22,190,041 (GRCm39) T289I probably damaging Het
Zfp819 G T 7: 43,267,209 (GRCm39) R488L probably damaging Het
Zfp942 C T 17: 22,147,285 (GRCm39) G448D probably benign Het
Zscan12 A G 13: 21,550,875 (GRCm39) K165E possibly damaging Het
Other mutations in Dnajc11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01769:Dnajc11 APN 4 152,063,759 (GRCm39) missense probably damaging 0.99
IGL02253:Dnajc11 APN 4 152,034,976 (GRCm39) nonsense probably null
IGL02606:Dnajc11 APN 4 152,063,941 (GRCm39) missense probably benign 0.18
IGL02969:Dnajc11 APN 4 152,062,503 (GRCm39) missense probably benign 0.33
IGL03062:Dnajc11 APN 4 152,055,318 (GRCm39) missense possibly damaging 0.92
PIT4812001:Dnajc11 UTSW 4 152,037,346 (GRCm39) missense probably benign 0.04
R0601:Dnajc11 UTSW 4 152,054,393 (GRCm39) missense probably damaging 1.00
R0620:Dnajc11 UTSW 4 152,058,085 (GRCm39) missense possibly damaging 0.54
R0639:Dnajc11 UTSW 4 152,054,393 (GRCm39) missense probably damaging 1.00
R1694:Dnajc11 UTSW 4 152,063,730 (GRCm39) missense probably damaging 1.00
R4091:Dnajc11 UTSW 4 152,062,550 (GRCm39) unclassified probably benign
R4548:Dnajc11 UTSW 4 152,058,074 (GRCm39) missense possibly damaging 0.93
R4720:Dnajc11 UTSW 4 152,052,996 (GRCm39) missense probably damaging 1.00
R4732:Dnajc11 UTSW 4 152,055,424 (GRCm39) unclassified probably benign
R4751:Dnajc11 UTSW 4 152,052,999 (GRCm39) missense probably benign 0.01
R4895:Dnajc11 UTSW 4 152,064,390 (GRCm39) missense probably damaging 1.00
R5122:Dnajc11 UTSW 4 152,061,454 (GRCm39) missense possibly damaging 0.63
R5127:Dnajc11 UTSW 4 152,054,271 (GRCm39) unclassified probably benign
R5174:Dnajc11 UTSW 4 152,064,441 (GRCm39) missense probably damaging 1.00
R5180:Dnajc11 UTSW 4 152,054,396 (GRCm39) missense probably damaging 1.00
R5319:Dnajc11 UTSW 4 152,052,983 (GRCm39) missense probably damaging 1.00
R5624:Dnajc11 UTSW 4 152,063,967 (GRCm39) missense probably benign
R6056:Dnajc11 UTSW 4 152,062,583 (GRCm39) unclassified probably benign
R6434:Dnajc11 UTSW 4 152,063,751 (GRCm39) missense probably damaging 1.00
R7635:Dnajc11 UTSW 4 152,053,068 (GRCm39) missense probably damaging 1.00
R7652:Dnajc11 UTSW 4 152,058,682 (GRCm39) missense probably damaging 0.99
R7937:Dnajc11 UTSW 4 152,034,909 (GRCm39) missense probably damaging 1.00
R7940:Dnajc11 UTSW 4 152,053,045 (GRCm39) missense probably benign 0.00
R8093:Dnajc11 UTSW 4 152,054,357 (GRCm39) missense probably damaging 1.00
R8361:Dnajc11 UTSW 4 152,055,368 (GRCm39) missense probably damaging 0.99
R8684:Dnajc11 UTSW 4 152,065,183 (GRCm39) makesense probably null
R9608:Dnajc11 UTSW 4 152,034,978 (GRCm39) missense possibly damaging 0.94
Z1176:Dnajc11 UTSW 4 152,018,240 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCCAGAAAGAGGCTGTGGG -3'
(R):5'- CAGTAGCTGTCACTGATGAACC -3'

Sequencing Primer
(F):5'- CTGTGGGCTCAGAAGTCATC -3'
(R):5'- TGATGAACCTGCCTGCACAG -3'
Posted On 2015-08-18