Incidental Mutation 'R4545:Sema3c'
ID333710
Institutional Source Beutler Lab
Gene Symbol Sema3c
Ensembl Gene ENSMUSG00000028780
Gene Namesema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C
Synonyms1110036B02Rik, Semae
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4545 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location17574281-17730268 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 17694772 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 421 (V421I)
Ref Sequence ENSEMBL: ENSMUSP00000030568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030568]
AlphaFold Q62181
Predicted Effect probably benign
Transcript: ENSMUST00000030568
AA Change: V421I

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000030568
Gene: ENSMUSG00000028780
AA Change: V421I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Sema 54 495 1.16e-200 SMART
PSI 513 565 2.87e-13 SMART
IG 577 662 7.08e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115271
Meta Mutation Damage Score 0.0726 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (41/42)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU mutation exhibit perinatal lethality, hypopigmentation and abnormal heart development. Mice homozygous for a knock-out allele exhibit prenatal lethality associated with heart defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Atf7 A G 15: 102,534,327 V449A probably benign Het
Ccr1 G A 9: 123,964,400 A31V probably benign Het
Chrna6 A T 8: 27,406,683 S389T probably benign Het
Clic6 C T 16: 92,492,157 probably benign Het
Cmya5 G A 13: 93,091,918 R2221* probably null Het
Coq8b G T 7: 27,233,505 C13F probably benign Het
Cspg4 T A 9: 56,888,629 L1216Q possibly damaging Het
Decr1 C A 4: 15,930,979 V118F probably damaging Het
Dlec1 A T 9: 119,128,078 I796F probably damaging Het
Dnajc11 T A 4: 151,979,941 D516E probably damaging Het
Dock8 G A 19: 25,188,358 V1869M probably damaging Het
Dst A G 1: 34,188,738 D1982G probably damaging Het
Gm11808 C T 4: 3,973,244 R106H probably benign Het
Gnptab G A 10: 88,414,595 D190N probably benign Het
Golga4 A G 9: 118,556,845 K22E probably damaging Het
Hecw2 T C 1: 53,813,222 *1579W probably null Het
Ica1l A G 1: 60,013,818 probably null Het
Ift122 T A 6: 115,890,588 L433Q probably damaging Het
Iqgap1 T C 7: 80,762,567 probably null Het
Klra13-ps T C 6: 130,291,269 noncoding transcript Het
Mndal A T 1: 173,875,664 Y58* probably null Het
Mvb12b G C 2: 33,827,700 P172R possibly damaging Het
Ncapg T C 5: 45,671,212 F102L probably damaging Het
Olfr1447 T A 19: 12,901,268 K171* probably null Het
Olfr235 T C 19: 12,268,824 V198A possibly damaging Het
Olfr390 T C 11: 73,787,166 V76A probably damaging Het
Pde8a A T 7: 81,328,099 R713S probably damaging Het
Rbks T C 5: 31,624,568 N296S probably benign Het
Tm9sf1 A G 14: 55,638,108 V393A possibly damaging Het
Tubgcp2 G A 7: 139,996,071 P893L possibly damaging Het
Vnn3 G A 10: 23,856,326 R158H probably benign Het
Zfa-ps G T 10: 52,544,936 noncoding transcript Het
Zfp414 T C 17: 33,631,648 probably benign Het
Zfp810 G A 9: 22,278,745 T289I probably damaging Het
Zfp819 G T 7: 43,617,785 R488L probably damaging Het
Zfp942 C T 17: 21,928,304 G448D probably benign Het
Zscan12 A G 13: 21,366,705 K165E possibly damaging Het
Other mutations in Sema3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Sema3c APN 5 17694860 missense probably damaging 1.00
IGL01528:Sema3c APN 5 17714415 missense probably benign
IGL01618:Sema3c APN 5 17672506 missense probably damaging 1.00
IGL01730:Sema3c APN 5 17711436 missense probably benign 0.01
IGL01762:Sema3c APN 5 17694851 missense possibly damaging 0.81
IGL02049:Sema3c APN 5 17721925 splice site probably benign
IGL02249:Sema3c APN 5 17662963 missense probably damaging 1.00
IGL02657:Sema3c APN 5 17576868 start codon destroyed possibly damaging 0.71
IGL02657:Sema3c APN 5 17662974 missense probably damaging 1.00
IGL03213:Sema3c APN 5 17694639 splice site probably benign
PIT4651001:Sema3c UTSW 5 17694733 missense probably benign 0.37
R0031:Sema3c UTSW 5 17694728 missense probably damaging 1.00
R0558:Sema3c UTSW 5 17714415 missense probably benign 0.00
R0964:Sema3c UTSW 5 17721909 missense probably damaging 1.00
R1164:Sema3c UTSW 5 17678314 missense probably benign 0.40
R1351:Sema3c UTSW 5 17678336 missense possibly damaging 0.60
R1368:Sema3c UTSW 5 17678332 missense possibly damaging 0.96
R1480:Sema3c UTSW 5 17682031 missense possibly damaging 0.57
R1880:Sema3c UTSW 5 17727466 nonsense probably null
R1916:Sema3c UTSW 5 17727401 missense probably benign 0.06
R3934:Sema3c UTSW 5 17681940 missense probably damaging 0.97
R4284:Sema3c UTSW 5 17678347 missense probably benign 0.01
R4449:Sema3c UTSW 5 17576846 start gained probably benign
R4546:Sema3c UTSW 5 17694772 missense probably benign 0.01
R4660:Sema3c UTSW 5 17672513 missense probably damaging 1.00
R4890:Sema3c UTSW 5 17675159 missense probably benign 0.00
R4937:Sema3c UTSW 5 17694686 missense probably benign 0.01
R5065:Sema3c UTSW 5 17727617 missense possibly damaging 0.89
R5145:Sema3c UTSW 5 17727617 missense possibly damaging 0.89
R5452:Sema3c UTSW 5 17717070 critical splice donor site probably null
R5586:Sema3c UTSW 5 17711424 missense probably damaging 0.99
R5811:Sema3c UTSW 5 17675190 splice site probably null
R5886:Sema3c UTSW 5 17681986 missense possibly damaging 0.90
R6120:Sema3c UTSW 5 17727632 missense probably benign 0.00
R6191:Sema3c UTSW 5 17653806 missense probably damaging 1.00
R6318:Sema3c UTSW 5 17672432 missense probably damaging 0.96
R6416:Sema3c UTSW 5 17576961 missense probably damaging 0.99
R6441:Sema3c UTSW 5 17724132 missense possibly damaging 0.96
R6816:Sema3c UTSW 5 17670465 missense probably benign 0.36
R7146:Sema3c UTSW 5 17694703 missense probably benign 0.22
R7526:Sema3c UTSW 5 17727596 missense possibly damaging 0.46
R7832:Sema3c UTSW 5 17694847 missense probably damaging 0.99
R8034:Sema3c UTSW 5 17727482 missense probably damaging 1.00
R8053:Sema3c UTSW 5 17655022 missense probably benign 0.00
R8076:Sema3c UTSW 5 17727364 missense probably benign 0.00
R8264:Sema3c UTSW 5 17676539 intron probably benign
R8359:Sema3c UTSW 5 17653728 missense possibly damaging 0.56
R8437:Sema3c UTSW 5 17662938 missense probably damaging 0.99
Z1176:Sema3c UTSW 5 17727519 missense probably benign 0.04
Z1177:Sema3c UTSW 5 17717031 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTCAAGACTCTCCTTGTC -3'
(R):5'- AGTCAGGTAAAGACTAAACGCC -3'

Sequencing Primer
(F):5'- GTCCTTCTCAGAAGATCTTCAATG -3'
(R):5'- GGTAAAGACTAAACGCCTCACTAAAG -3'
Posted On2015-08-18