Incidental Mutation 'R4545:Rbks'
ID333711
Institutional Source Beutler Lab
Gene Symbol Rbks
Ensembl Gene ENSMUSG00000029136
Gene Nameribokinase
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.357) question?
Stock #R4545 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location31624439-31697627 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31624568 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 296 (N296S)
Ref Sequence ENSEMBL: ENSMUSP00000031018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031018] [ENSMUST00000031024] [ENSMUST00000201910]
Predicted Effect probably benign
Transcript: ENSMUST00000031018
AA Change: N296S

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000031018
Gene: ENSMUSG00000029136
AA Change: N296S

DomainStartEndE-ValueType
Pfam:PfkB 16 315 2.1e-66 PFAM
Pfam:Phos_pyr_kin 166 306 9.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031024
SMART Domains Protein: ENSMUSP00000031024
Gene: ENSMUSG00000106918

DomainStartEndE-ValueType
Pfam:Ribosomal_L33 16 60 1.3e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200694
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201744
Predicted Effect probably benign
Transcript: ENSMUST00000201910
SMART Domains Protein: ENSMUSP00000144669
Gene: ENSMUSG00000106918

DomainStartEndE-ValueType
PDB:4CE4|6 1 49 9e-15 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201999
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202655
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202953
Meta Mutation Damage Score 0.2050 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carbohydrate kinase PfkB family. The encoded protein phosphorylates ribose to form ribose-5-phosphate in the presence of ATP and magnesium as a first step in ribose metabolism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Atf7 A G 15: 102,534,327 V449A probably benign Het
Ccr1 G A 9: 123,964,400 A31V probably benign Het
Chrna6 A T 8: 27,406,683 S389T probably benign Het
Clic6 C T 16: 92,492,157 probably benign Het
Cmya5 G A 13: 93,091,918 R2221* probably null Het
Coq8b G T 7: 27,233,505 C13F probably benign Het
Cspg4 T A 9: 56,888,629 L1216Q possibly damaging Het
Decr1 C A 4: 15,930,979 V118F probably damaging Het
Dlec1 A T 9: 119,128,078 I796F probably damaging Het
Dnajc11 T A 4: 151,979,941 D516E probably damaging Het
Dock8 G A 19: 25,188,358 V1869M probably damaging Het
Dst A G 1: 34,188,738 D1982G probably damaging Het
Gm11808 C T 4: 3,973,244 R106H probably benign Het
Gnptab G A 10: 88,414,595 D190N probably benign Het
Golga4 A G 9: 118,556,845 K22E probably damaging Het
Hecw2 T C 1: 53,813,222 *1579W probably null Het
Ica1l A G 1: 60,013,818 probably null Het
Ift122 T A 6: 115,890,588 L433Q probably damaging Het
Iqgap1 T C 7: 80,762,567 probably null Het
Klra13-ps T C 6: 130,291,269 noncoding transcript Het
Mndal A T 1: 173,875,664 Y58* probably null Het
Mvb12b G C 2: 33,827,700 P172R possibly damaging Het
Ncapg T C 5: 45,671,212 F102L probably damaging Het
Olfr1447 T A 19: 12,901,268 K171* probably null Het
Olfr235 T C 19: 12,268,824 V198A possibly damaging Het
Olfr390 T C 11: 73,787,166 V76A probably damaging Het
Pde8a A T 7: 81,328,099 R713S probably damaging Het
Sema3c G A 5: 17,694,772 V421I probably benign Het
Tm9sf1 A G 14: 55,638,108 V393A possibly damaging Het
Tubgcp2 G A 7: 139,996,071 P893L possibly damaging Het
Vnn3 G A 10: 23,856,326 R158H probably benign Het
Zfa-ps G T 10: 52,544,936 noncoding transcript Het
Zfp414 T C 17: 33,631,648 probably benign Het
Zfp810 G A 9: 22,278,745 T289I probably damaging Het
Zfp819 G T 7: 43,617,785 R488L probably damaging Het
Zfp942 C T 17: 21,928,304 G448D probably benign Het
Zscan12 A G 13: 21,366,705 K165E possibly damaging Het
Other mutations in Rbks
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:Rbks APN 5 31660017 missense probably damaging 1.00
IGL02618:Rbks APN 5 31624519 nonsense probably null
IGL02678:Rbks APN 5 31673413 missense probably damaging 1.00
IGL02719:Rbks APN 5 31651801 intron probably benign
IGL02947:Rbks APN 5 31660063 missense probably benign
R0334:Rbks UTSW 5 31624519 nonsense probably null
R1441:Rbks UTSW 5 31659997 missense probably benign
R2568:Rbks UTSW 5 31665752 missense probably damaging 0.99
R4546:Rbks UTSW 5 31624568 missense probably benign 0.10
R4591:Rbks UTSW 5 31660008 missense possibly damaging 0.52
R4833:Rbks UTSW 5 31624515 missense probably benign 0.00
R4967:Rbks UTSW 5 31624532 missense probably damaging 1.00
R5076:Rbks UTSW 5 31650451 nonsense probably null
R5214:Rbks UTSW 5 31650392 intron probably benign
R6051:Rbks UTSW 5 31651819 missense probably damaging 1.00
R6194:Rbks UTSW 5 31666890 missense probably benign 0.05
R6607:Rbks UTSW 5 31647792 missense possibly damaging 0.92
R7246:Rbks UTSW 5 31647783 missense possibly damaging 0.58
Z1177:Rbks UTSW 5 31647863 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CATCACTAACTCAAAGAGGGCTTG -3'
(R):5'- TCCTTTTCTGGAACTCTGAAGC -3'

Sequencing Primer
(F):5'- CTCAAAGAGGGCTTGATAACTTC -3'
(R):5'- TGGGTACTAAAGCTTGAACCTC -3'
Posted On2015-08-18