Mutagenetix > Incidental Mutations

Incidental Mutation 'R4545:Rbks'

333711

Institutional Source

Beutler Lab

Gene Symbol

Rbks

Ensembl Gene

ENSMUSG00000029136

Gene Name

ribokinase

Synonyms

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.384) question?

Stock #

R4545 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

31624439-31697627 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 31624568 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 296 (N296S)

Ref Sequence

ENSEMBL: ENSMUSP00000031018 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031018] [ENSMUST00000031024] [ENSMUST00000201910]

Predicted Effect

probably benign
Transcript: ENSMUST00000031018
AA Change: N296S

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000031018
Gene: ENSMUSG00000029136
AA Change: N296S

Domain	Start	End	E-Value	Type
Pfam:PfkB	16	315	2.1e-66	PFAM
Pfam:Phos_pyr_kin	166	306	9.6e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000031024

SMART Domains

Protein: ENSMUSP00000031024
Gene: ENSMUSG00000106918

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L33	16	60	1.3e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200694

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201483

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201620

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201744

Predicted Effect

probably benign
Transcript: ENSMUST00000201910

SMART Domains

Protein: ENSMUSP00000144669
Gene: ENSMUSG00000106918

Domain	Start	End	E-Value	Type
PDB:4CE4\|6	1	49	9e-15	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201923

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201999

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202033

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202243

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202655

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202953

Meta Mutation Damage Score

0.2050

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

98% (41/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carbohydrate kinase PfkB family. The encoded protein phosphorylates ribose to form ribose-5-phosphate in the presence of ATP and magnesium as a first step in ribose metabolism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akr1c20	A	C	13: 4,507,844	V201G	probably damaging	Het
Atf7	A	G	15: 102,534,327	V449A	probably benign	Het
Ccr1	G	A	9: 123,964,400	A31V	probably benign	Het
Chrna6	A	T	8: 27,406,683	S389T	probably benign	Het
Clic6	C	T	16: 92,492,157		probably benign	Het
Cmya5	G	A	13: 93,091,918	R2221*	probably null	Het
Coq8b	G	T	7: 27,233,505	C13F	probably benign	Het
Cspg4	T	A	9: 56,888,629	L1216Q	possibly damaging	Het
Decr1	C	A	4: 15,930,979	V118F	probably damaging	Het
Dlec1	A	T	9: 119,128,078	I796F	probably damaging	Het
Dnajc11	T	A	4: 151,979,941	D516E	probably damaging	Het
Dock8	G	A	19: 25,188,358	V1869M	probably damaging	Het
Dst	A	G	1: 34,188,738	D1982G	probably damaging	Het
Gm11808	C	T	4: 3,973,244	R106H	probably benign	Het
Gnptab	G	A	10: 88,414,595	D190N	probably benign	Het
Golga4	A	G	9: 118,556,845	K22E	probably damaging	Het
Hecw2	T	C	1: 53,813,222	*1579W	probably null	Het
Ica1l	A	G	1: 60,013,818		probably null	Het
Ift122	T	A	6: 115,890,588	L433Q	probably damaging	Het
Iqgap1	T	C	7: 80,762,567		probably null	Het
Klra13-ps	T	C	6: 130,291,269		noncoding transcript	Het
Mndal	A	T	1: 173,875,664	Y58*	probably null	Het
Mvb12b	G	C	2: 33,827,700	P172R	possibly damaging	Het
Ncapg	T	C	5: 45,671,212	F102L	probably damaging	Het
Olfr1447	T	A	19: 12,901,268	K171*	probably null	Het
Olfr235	T	C	19: 12,268,824	V198A	possibly damaging	Het
Olfr390	T	C	11: 73,787,166	V76A	probably damaging	Het
Pde8a	A	T	7: 81,328,099	R713S	probably damaging	Het
Sema3c	G	A	5: 17,694,772	V421I	probably benign	Het
Tm9sf1	A	G	14: 55,638,108	V393A	possibly damaging	Het
Tubgcp2	G	A	7: 139,996,071	P893L	possibly damaging	Het
Vnn3	G	A	10: 23,856,326	R158H	probably benign	Het
Zfa-ps	G	T	10: 52,544,936		noncoding transcript	Het
Zfp414	T	C	17: 33,631,648		probably benign	Het
Zfp810	G	A	9: 22,278,745	T289I	probably damaging	Het
Zfp819	G	T	7: 43,617,785	R488L	probably damaging	Het
Zfp942	C	T	17: 21,928,304	G448D	probably benign	Het
Zscan12	A	G	13: 21,366,705	K165E	possibly damaging	Het

Other mutations in Rbks

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02019:Rbks	APN	5	31660017	missense	probably damaging	1.00
IGL02618:Rbks	APN	5	31624519	nonsense	probably null
IGL02678:Rbks	APN	5	31673413	missense	probably damaging	1.00
IGL02719:Rbks	APN	5	31651801	intron	probably benign
IGL02947:Rbks	APN	5	31660063	missense	probably benign
R0334:Rbks	UTSW	5	31624519	nonsense	probably null
R1441:Rbks	UTSW	5	31659997	missense	probably benign
R2568:Rbks	UTSW	5	31665752	missense	probably damaging	0.99
R4546:Rbks	UTSW	5	31624568	missense	probably benign	0.10
R4591:Rbks	UTSW	5	31660008	missense	possibly damaging	0.52
R4833:Rbks	UTSW	5	31624515	missense	probably benign	0.00
R4967:Rbks	UTSW	5	31624532	missense	probably damaging	1.00
R5076:Rbks	UTSW	5	31650451	nonsense	probably null
R5214:Rbks	UTSW	5	31650392	intron	probably benign
R6051:Rbks	UTSW	5	31651819	missense	probably damaging	1.00
R6194:Rbks	UTSW	5	31666890	missense	probably benign	0.05
R6607:Rbks	UTSW	5	31647792	missense	possibly damaging	0.92
R7246:Rbks	UTSW	5	31647783	missense	possibly damaging	0.58
R8270:Rbks	UTSW	5	31650466	intron	probably benign
R9070:Rbks	UTSW	5	31697546	missense	probably benign	0.02
Z1177:Rbks	UTSW	5	31647863	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CATCACTAACTCAAAGAGGGCTTG -3'
(R):5'- TCCTTTTCTGGAACTCTGAAGC -3'

Sequencing Primer
(F):5'- CTCAAAGAGGGCTTGATAACTTC -3'
(R):5'- TGGGTACTAAAGCTTGAACCTC -3'

Posted On

2015-08-18