Incidental Mutation 'R4545:Rbks'
ID 333711
Institutional Source Beutler Lab
Gene Symbol Rbks
Ensembl Gene ENSMUSG00000029136
Gene Name ribokinase
Synonyms 5230400M11Rik
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.343) question?
Stock # R4545 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 31781783-31854971 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 31781912 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 296 (N296S)
Ref Sequence ENSEMBL: ENSMUSP00000031018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031018] [ENSMUST00000031024] [ENSMUST00000201910]
AlphaFold Q8R1Q9
Predicted Effect probably benign
Transcript: ENSMUST00000031018
AA Change: N296S

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000031018
Gene: ENSMUSG00000029136
AA Change: N296S

DomainStartEndE-ValueType
Pfam:PfkB 16 315 2.1e-66 PFAM
Pfam:Phos_pyr_kin 166 306 9.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031024
SMART Domains Protein: ENSMUSP00000031024
Gene: ENSMUSG00000106918

DomainStartEndE-ValueType
Pfam:Ribosomal_L33 16 60 1.3e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200694
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201744
Predicted Effect probably benign
Transcript: ENSMUST00000201910
SMART Domains Protein: ENSMUSP00000144669
Gene: ENSMUSG00000106918

DomainStartEndE-ValueType
PDB:4CE4|6 1 49 9e-15 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201999
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202953
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202655
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202033
Meta Mutation Damage Score 0.2050 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carbohydrate kinase PfkB family. The encoded protein phosphorylates ribose to form ribose-5-phosphate in the presence of ATP and magnesium as a first step in ribose metabolism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 A C 13: 4,557,843 (GRCm39) V201G probably damaging Het
Atf7 A G 15: 102,442,762 (GRCm39) V449A probably benign Het
Ccr1 G A 9: 123,764,437 (GRCm39) A31V probably benign Het
Chrna6 A T 8: 27,896,711 (GRCm39) S389T probably benign Het
Clic6 C T 16: 92,289,045 (GRCm39) probably benign Het
Cmya5 G A 13: 93,228,426 (GRCm39) R2221* probably null Het
Coq8b G T 7: 26,932,930 (GRCm39) C13F probably benign Het
Cspg4 T A 9: 56,795,913 (GRCm39) L1216Q possibly damaging Het
Decr1 C A 4: 15,930,979 (GRCm39) V118F probably damaging Het
Dlec1 A T 9: 118,957,146 (GRCm39) I796F probably damaging Het
Dnajc11 T A 4: 152,064,398 (GRCm39) D516E probably damaging Het
Dock8 G A 19: 25,165,722 (GRCm39) V1869M probably damaging Het
Dst A G 1: 34,227,819 (GRCm39) D1982G probably damaging Het
Gnptab G A 10: 88,250,457 (GRCm39) D190N probably benign Het
Golga4 A G 9: 118,385,913 (GRCm39) K22E probably damaging Het
Hecw2 T C 1: 53,852,381 (GRCm39) *1579W probably null Het
Ica1l A G 1: 60,052,977 (GRCm39) probably null Het
Ift122 T A 6: 115,867,549 (GRCm39) L433Q probably damaging Het
Iqgap1 T C 7: 80,412,315 (GRCm39) probably null Het
Klra13-ps T C 6: 130,268,232 (GRCm39) noncoding transcript Het
Mndal A T 1: 173,703,230 (GRCm39) Y58* probably null Het
Mvb12b G C 2: 33,717,712 (GRCm39) P172R possibly damaging Het
Ncapg T C 5: 45,828,554 (GRCm39) F102L probably damaging Het
Or1e30 T C 11: 73,677,992 (GRCm39) V76A probably damaging Het
Or5an11 T C 19: 12,246,188 (GRCm39) V198A possibly damaging Het
Or5b97 T A 19: 12,878,632 (GRCm39) K171* probably null Het
Pde8a A T 7: 80,977,847 (GRCm39) R713S probably damaging Het
Sema3c G A 5: 17,899,770 (GRCm39) V421I probably benign Het
Tm9sf1 A G 14: 55,875,565 (GRCm39) V393A possibly damaging Het
Tubgcp2 G A 7: 139,575,984 (GRCm39) P893L possibly damaging Het
Uba52rt C T 4: 3,973,244 (GRCm39) R106H probably benign Het
Vnn3 G A 10: 23,732,224 (GRCm39) R158H probably benign Het
Zfa-ps G T 10: 52,421,032 (GRCm39) noncoding transcript Het
Zfp414 T C 17: 33,850,622 (GRCm39) probably benign Het
Zfp810 G A 9: 22,190,041 (GRCm39) T289I probably damaging Het
Zfp819 G T 7: 43,267,209 (GRCm39) R488L probably damaging Het
Zfp942 C T 17: 22,147,285 (GRCm39) G448D probably benign Het
Zscan12 A G 13: 21,550,875 (GRCm39) K165E possibly damaging Het
Other mutations in Rbks
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:Rbks APN 5 31,817,361 (GRCm39) missense probably damaging 1.00
IGL02618:Rbks APN 5 31,781,863 (GRCm39) nonsense probably null
IGL02678:Rbks APN 5 31,830,757 (GRCm39) missense probably damaging 1.00
IGL02719:Rbks APN 5 31,809,145 (GRCm39) intron probably benign
IGL02947:Rbks APN 5 31,817,407 (GRCm39) missense probably benign
R0334:Rbks UTSW 5 31,781,863 (GRCm39) nonsense probably null
R1441:Rbks UTSW 5 31,817,341 (GRCm39) missense probably benign
R2568:Rbks UTSW 5 31,823,096 (GRCm39) missense probably damaging 0.99
R4546:Rbks UTSW 5 31,781,912 (GRCm39) missense probably benign 0.10
R4591:Rbks UTSW 5 31,817,352 (GRCm39) missense possibly damaging 0.52
R4833:Rbks UTSW 5 31,781,859 (GRCm39) missense probably benign 0.00
R4967:Rbks UTSW 5 31,781,876 (GRCm39) missense probably damaging 1.00
R5076:Rbks UTSW 5 31,807,795 (GRCm39) nonsense probably null
R5214:Rbks UTSW 5 31,807,736 (GRCm39) intron probably benign
R6051:Rbks UTSW 5 31,809,163 (GRCm39) missense probably damaging 1.00
R6194:Rbks UTSW 5 31,824,234 (GRCm39) missense probably benign 0.05
R6607:Rbks UTSW 5 31,805,136 (GRCm39) missense possibly damaging 0.92
R7246:Rbks UTSW 5 31,805,127 (GRCm39) missense possibly damaging 0.58
R8270:Rbks UTSW 5 31,807,810 (GRCm39) intron probably benign
R9070:Rbks UTSW 5 31,854,890 (GRCm39) missense probably benign 0.02
Z1177:Rbks UTSW 5 31,805,207 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CATCACTAACTCAAAGAGGGCTTG -3'
(R):5'- TCCTTTTCTGGAACTCTGAAGC -3'

Sequencing Primer
(F):5'- CTCAAAGAGGGCTTGATAACTTC -3'
(R):5'- TGGGTACTAAAGCTTGAACCTC -3'
Posted On 2015-08-18