Mutagenetix > Incidental Mutation

Incidental Mutation 'R4545:Ncapg'

333713

Institutional Source

Beutler Lab

Gene Symbol

Ncapg

Ensembl Gene

ENSMUSG00000015880

Gene Name

non-SMC condensin I complex, subunit G

Synonyms

5730507H05Rik, MFT.M05.13, Hcapg

Accession Numbers

Essential gene?

Probably essential (E-score: 0.945) question?

Stock #

R4545 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

45669919-45700546 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 45671212 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 102 (F102L)

Ref Sequence

ENSEMBL: ENSMUSP00000112871 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000117396]

AlphaFold

E9PWG6

Predicted Effect

probably damaging
Transcript: ENSMUST00000117396
AA Change: F102L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112871
Gene: ENSMUSG00000015880
AA Change: F102L

Domain	Start	End	E-Value	Type
Pfam:Cnd3	557	863	7.4e-87	PFAM
low complexity region	864	874	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134309

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196242

Meta Mutation Damage Score

0.6324

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

98% (41/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the condensin complex, which is responsible for the condensation and stabilization of chromosomes during mitosis and meiosis. Phosphorylation of the encoded protein activates the condensin complex. There are pseudogenes for this gene on chromosomes 8 and 15. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akr1c20	A	C	13: 4,507,844	V201G	probably damaging	Het
Atf7	A	G	15: 102,534,327	V449A	probably benign	Het
Ccr1	G	A	9: 123,964,400	A31V	probably benign	Het
Chrna6	A	T	8: 27,406,683	S389T	probably benign	Het
Clic6	C	T	16: 92,492,157		probably benign	Het
Cmya5	G	A	13: 93,091,918	R2221*	probably null	Het
Coq8b	G	T	7: 27,233,505	C13F	probably benign	Het
Cspg4	T	A	9: 56,888,629	L1216Q	possibly damaging	Het
Decr1	C	A	4: 15,930,979	V118F	probably damaging	Het
Dlec1	A	T	9: 119,128,078	I796F	probably damaging	Het
Dnajc11	T	A	4: 151,979,941	D516E	probably damaging	Het
Dock8	G	A	19: 25,188,358	V1869M	probably damaging	Het
Dst	A	G	1: 34,188,738	D1982G	probably damaging	Het
Gm11808	C	T	4: 3,973,244	R106H	probably benign	Het
Gnptab	G	A	10: 88,414,595	D190N	probably benign	Het
Golga4	A	G	9: 118,556,845	K22E	probably damaging	Het
Hecw2	T	C	1: 53,813,222	*1579W	probably null	Het
Ica1l	A	G	1: 60,013,818		probably null	Het
Ift122	T	A	6: 115,890,588	L433Q	probably damaging	Het
Iqgap1	T	C	7: 80,762,567		probably null	Het
Klra13-ps	T	C	6: 130,291,269		noncoding transcript	Het
Mndal	A	T	1: 173,875,664	Y58*	probably null	Het
Mvb12b	G	C	2: 33,827,700	P172R	possibly damaging	Het
Olfr1447	T	A	19: 12,901,268	K171*	probably null	Het
Olfr235	T	C	19: 12,268,824	V198A	possibly damaging	Het
Olfr390	T	C	11: 73,787,166	V76A	probably damaging	Het
Pde8a	A	T	7: 81,328,099	R713S	probably damaging	Het
Rbks	T	C	5: 31,624,568	N296S	probably benign	Het
Sema3c	G	A	5: 17,694,772	V421I	probably benign	Het
Tm9sf1	A	G	14: 55,638,108	V393A	possibly damaging	Het
Tubgcp2	G	A	7: 139,996,071	P893L	possibly damaging	Het
Vnn3	G	A	10: 23,856,326	R158H	probably benign	Het
Zfa-ps	G	T	10: 52,544,936		noncoding transcript	Het
Zfp414	T	C	17: 33,631,648		probably benign	Het
Zfp810	G	A	9: 22,278,745	T289I	probably damaging	Het
Zfp819	G	T	7: 43,617,785	R488L	probably damaging	Het
Zfp942	C	T	17: 21,928,304	G448D	probably benign	Het
Zscan12	A	G	13: 21,366,705	K165E	possibly damaging	Het

Other mutations in Ncapg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00662:Ncapg	APN	5	45693160	missense	possibly damaging	0.53
IGL00777:Ncapg	APN	5	45695765	missense	possibly damaging	0.93
IGL00857:Ncapg	APN	5	45676585	splice site	probably null
IGL00916:Ncapg	APN	5	45671192	missense	probably benign	0.37
IGL01293:Ncapg	APN	5	45681854	missense	probably benign	0.01
IGL01360:Ncapg	APN	5	45674385	nonsense	probably null
IGL01462:Ncapg	APN	5	45671135	missense	probably benign	0.02
IGL01527:Ncapg	APN	5	45672384	missense	possibly damaging	0.71
IGL01732:Ncapg	APN	5	45693853	missense	probably damaging	1.00
IGL01788:Ncapg	APN	5	45671081	missense	probably damaging	0.97
IGL01871:Ncapg	APN	5	45688581	missense	probably benign	0.09
IGL03106:Ncapg	APN	5	45695668	missense	probably damaging	1.00
IGL03124:Ncapg	APN	5	45671209	missense	probably benign
R0086:Ncapg	UTSW	5	45676744	splice site	probably null
R0109:Ncapg	UTSW	5	45693748	splice site	probably null
R0110:Ncapg	UTSW	5	45693147	unclassified	probably benign
R0377:Ncapg	UTSW	5	45693817	missense	probably benign
R0432:Ncapg	UTSW	5	45672428	missense	probably damaging	0.99
R0637:Ncapg	UTSW	5	45687324	missense	probably damaging	1.00
R0835:Ncapg	UTSW	5	45681448	missense	probably damaging	0.96
R0894:Ncapg	UTSW	5	45679894	missense	probably null	0.24
R1069:Ncapg	UTSW	5	45675930	intron	probably benign
R1216:Ncapg	UTSW	5	45699919	missense	possibly damaging	0.68
R1967:Ncapg	UTSW	5	45699910	missense	probably damaging	0.99
R2396:Ncapg	UTSW	5	45678373	missense	probably benign	0.00
R3157:Ncapg	UTSW	5	45676058	missense	probably benign
R3735:Ncapg	UTSW	5	45696127	missense	probably benign	0.00
R3736:Ncapg	UTSW	5	45696127	missense	probably benign	0.00
R3887:Ncapg	UTSW	5	45674363	missense	probably benign
R4371:Ncapg	UTSW	5	45678455	missense	probably benign
R4546:Ncapg	UTSW	5	45671212	missense	probably damaging	1.00
R4558:Ncapg	UTSW	5	45676644	missense	probably benign	0.00
R4615:Ncapg	UTSW	5	45687399	missense	probably benign	0.00
R4938:Ncapg	UTSW	5	45671209	missense	probably benign
R5839:Ncapg	UTSW	5	45672278	missense	probably damaging	0.99
R5871:Ncapg	UTSW	5	45695697	missense	probably damaging	1.00
R6086:Ncapg	UTSW	5	45693236	missense	probably damaging	1.00
R6418:Ncapg	UTSW	5	45681816	missense	probably damaging	1.00
R6617:Ncapg	UTSW	5	45670132	missense	probably benign	0.03
R7145:Ncapg	UTSW	5	45670030	missense	possibly damaging	0.82
R7408:Ncapg	UTSW	5	45695793	missense	probably benign	0.00
R7443:Ncapg	UTSW	5	45672310	missense	probably benign	0.31
R7463:Ncapg	UTSW	5	45694092	splice site	probably null
R7509:Ncapg	UTSW	5	45696108	missense	probably benign	0.01
R7687:Ncapg	UTSW	5	45699885	missense	probably benign	0.03
R7919:Ncapg	UTSW	5	45696048	missense	probably benign	0.00
R8022:Ncapg	UTSW	5	45681794	missense	probably damaging	1.00
R8177:Ncapg	UTSW	5	45693753	missense	probably benign	0.00
R8261:Ncapg	UTSW	5	45687388	missense	possibly damaging	0.90
R8263:Ncapg	UTSW	5	45691792	missense	probably benign	0.44
R8324:Ncapg	UTSW	5	45695668	missense	probably damaging	1.00
R8333:Ncapg	UTSW	5	45674463	missense	probably damaging	0.96
R8742:Ncapg	UTSW	5	45693874	missense	probably damaging	1.00
R9026:Ncapg	UTSW	5	45695773	missense	probably benign	0.00
R9051:Ncapg	UTSW	5	45695798	missense	probably damaging	1.00
R9076:Ncapg	UTSW	5	45676641	missense	probably benign
R9122:Ncapg	UTSW	5	45688673	missense	possibly damaging	0.95
R9751:Ncapg	UTSW	5	45693853	missense	probably damaging	1.00
R9776:Ncapg	UTSW	5	45672492	missense	probably damaging	0.96
RF019:Ncapg	UTSW	5	45698856	missense	probably benign	0.00
Z1088:Ncapg	UTSW	5	45679880	missense	probably damaging	1.00
Z1177:Ncapg	UTSW	5	45672502	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TAATGCAGCTTCTGGAGGCG -3'
(R):5'- TGCTGTCACAAAATAAGCCTATCC -3'

Sequencing Primer
(F):5'- TGATAAAACAGCTTTTCAGGAGG -3'
(R):5'- CTTAATCGCAGAGAGAGGACATTTAC -3'

Posted On

2015-08-18