Incidental Mutation 'R4545:Ift122'
ID333714
Institutional Source Beutler Lab
Gene Symbol Ift122
Ensembl Gene ENSMUSG00000030323
Gene Nameintraflagellar transport 122
SynonymsC86139, sopb, Wdr10
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4545 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location115853470-115926699 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 115890588 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 433 (L433Q)
Ref Sequence ENSEMBL: ENSMUSP00000045468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038234] [ENSMUST00000112923] [ENSMUST00000112925] [ENSMUST00000141305]
AlphaFold Q6NWV3
Predicted Effect probably damaging
Transcript: ENSMUST00000038234
AA Change: L433Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045468
Gene: ENSMUSG00000030323
AA Change: L433Q

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
WD40 162 208 2.29e1 SMART
WD40 210 249 1.91e1 SMART
WD40 251 290 3.45e-3 SMART
WD40 448 483 1.43e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112923
AA Change: L492Q

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108545
Gene: ENSMUSG00000030323
AA Change: L492Q

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
Blast:WD40 163 267 3e-46 BLAST
WD40 269 308 1.91e1 SMART
WD40 310 349 3.45e-3 SMART
WD40 507 542 1.43e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112925
AA Change: L433Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108547
Gene: ENSMUSG00000030323
AA Change: L433Q

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
WD40 162 208 2.29e1 SMART
WD40 210 249 1.91e1 SMART
WD40 251 290 3.45e-3 SMART
WD40 448 483 1.43e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138113
Predicted Effect probably benign
Transcript: ENSMUST00000141305
SMART Domains Protein: ENSMUSP00000138535
Gene: ENSMUSG00000030323

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
low complexity region 124 134 N/A INTRINSIC
low complexity region 162 176 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152092
Meta Mutation Damage Score 0.7417 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This cytoplasmic protein contains seven WD repeats and an AF-2 domain which function by recruiting coregulatory molecules and in transcriptional activation. Mutations in this gene cause cranioectodermal dysplasia-1. A related pseudogene is located on chromosome 3. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for a null mutation display embryonic lethality during organogenesis with exencephaly, a ventralized caudal neural tube, preaxial polydactyly, abnormal cilia, and left-right patterning defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Atf7 A G 15: 102,534,327 V449A probably benign Het
Ccr1 G A 9: 123,964,400 A31V probably benign Het
Chrna6 A T 8: 27,406,683 S389T probably benign Het
Clic6 C T 16: 92,492,157 probably benign Het
Cmya5 G A 13: 93,091,918 R2221* probably null Het
Coq8b G T 7: 27,233,505 C13F probably benign Het
Cspg4 T A 9: 56,888,629 L1216Q possibly damaging Het
Decr1 C A 4: 15,930,979 V118F probably damaging Het
Dlec1 A T 9: 119,128,078 I796F probably damaging Het
Dnajc11 T A 4: 151,979,941 D516E probably damaging Het
Dock8 G A 19: 25,188,358 V1869M probably damaging Het
Dst A G 1: 34,188,738 D1982G probably damaging Het
Gm11808 C T 4: 3,973,244 R106H probably benign Het
Gnptab G A 10: 88,414,595 D190N probably benign Het
Golga4 A G 9: 118,556,845 K22E probably damaging Het
Hecw2 T C 1: 53,813,222 *1579W probably null Het
Ica1l A G 1: 60,013,818 probably null Het
Iqgap1 T C 7: 80,762,567 probably null Het
Klra13-ps T C 6: 130,291,269 noncoding transcript Het
Mndal A T 1: 173,875,664 Y58* probably null Het
Mvb12b G C 2: 33,827,700 P172R possibly damaging Het
Ncapg T C 5: 45,671,212 F102L probably damaging Het
Olfr1447 T A 19: 12,901,268 K171* probably null Het
Olfr235 T C 19: 12,268,824 V198A possibly damaging Het
Olfr390 T C 11: 73,787,166 V76A probably damaging Het
Pde8a A T 7: 81,328,099 R713S probably damaging Het
Rbks T C 5: 31,624,568 N296S probably benign Het
Sema3c G A 5: 17,694,772 V421I probably benign Het
Tm9sf1 A G 14: 55,638,108 V393A possibly damaging Het
Tubgcp2 G A 7: 139,996,071 P893L possibly damaging Het
Vnn3 G A 10: 23,856,326 R158H probably benign Het
Zfa-ps G T 10: 52,544,936 noncoding transcript Het
Zfp414 T C 17: 33,631,648 probably benign Het
Zfp810 G A 9: 22,278,745 T289I probably damaging Het
Zfp819 G T 7: 43,617,785 R488L probably damaging Het
Zfp942 C T 17: 21,928,304 G448D probably benign Het
Zscan12 A G 13: 21,366,705 K165E possibly damaging Het
Other mutations in Ift122
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Ift122 APN 6 115917057 missense probably benign 0.10
IGL00783:Ift122 APN 6 115905902 missense probably benign
IGL00784:Ift122 APN 6 115905902 missense probably benign
IGL00799:Ift122 APN 6 115877536 missense probably damaging 1.00
IGL00908:Ift122 APN 6 115913909 missense probably benign 0.00
IGL01012:Ift122 APN 6 115899491 missense probably damaging 0.99
IGL01444:Ift122 APN 6 115884379 missense probably benign 0.08
IGL01451:Ift122 APN 6 115912604 critical splice donor site probably null
IGL01940:Ift122 APN 6 115887371 splice site probably benign
IGL02089:Ift122 APN 6 115925437 missense probably benign 0.00
IGL02331:Ift122 APN 6 115887324 missense probably damaging 1.00
IGL02929:Ift122 APN 6 115902877 missense probably damaging 1.00
IGL03169:Ift122 APN 6 115905961 splice site probably benign
PIT1430001:Ift122 UTSW 6 115925744 splice site probably benign
R0158:Ift122 UTSW 6 115924484 splice site probably benign
R0496:Ift122 UTSW 6 115905902 missense probably benign
R1065:Ift122 UTSW 6 115875325 splice site probably null
R1670:Ift122 UTSW 6 115923883 missense probably benign 0.05
R1861:Ift122 UTSW 6 115891928 missense probably damaging 1.00
R1889:Ift122 UTSW 6 115894421 critical splice donor site probably null
R1990:Ift122 UTSW 6 115924367 missense probably damaging 1.00
R2362:Ift122 UTSW 6 115884350 missense probably damaging 0.99
R2385:Ift122 UTSW 6 115912522 missense probably benign 0.21
R3734:Ift122 UTSW 6 115925501 splice site probably benign
R3800:Ift122 UTSW 6 115925906 missense probably benign 0.03
R3981:Ift122 UTSW 6 115913921 missense probably benign 0.02
R4289:Ift122 UTSW 6 115923891 missense probably damaging 1.00
R4546:Ift122 UTSW 6 115890588 missense probably damaging 1.00
R4641:Ift122 UTSW 6 115888765 nonsense probably null
R4815:Ift122 UTSW 6 115881556 missense possibly damaging 0.95
R4854:Ift122 UTSW 6 115862746 missense possibly damaging 0.61
R4928:Ift122 UTSW 6 115915858 utr 3 prime probably benign
R5021:Ift122 UTSW 6 115864372 missense probably benign 0.41
R5121:Ift122 UTSW 6 115912534 missense probably benign 0.04
R5200:Ift122 UTSW 6 115920379 missense probably damaging 0.99
R5549:Ift122 UTSW 6 115892022 missense probably damaging 1.00
R6111:Ift122 UTSW 6 115875286 missense probably damaging 1.00
R6141:Ift122 UTSW 6 115916011 missense probably damaging 0.99
R6766:Ift122 UTSW 6 115926243 missense probably benign 0.15
R7379:Ift122 UTSW 6 115926302 missense probably benign
R7402:Ift122 UTSW 6 115894322 missense probably benign 0.00
R7436:Ift122 UTSW 6 115926302 missense probably benign
R7437:Ift122 UTSW 6 115926302 missense probably benign
R7438:Ift122 UTSW 6 115926302 missense probably benign
R7517:Ift122 UTSW 6 115890582 missense probably benign 0.37
R7978:Ift122 UTSW 6 115920352 missense probably benign 0.37
R8492:Ift122 UTSW 6 115887005 missense probably benign 0.02
R8493:Ift122 UTSW 6 115910331 missense probably benign 0.01
R8669:Ift122 UTSW 6 115923291 missense probably damaging 0.98
R8867:Ift122 UTSW 6 115880671 missense probably damaging 1.00
R8887:Ift122 UTSW 6 115891919 missense probably benign 0.00
R8947:Ift122 UTSW 6 115924407 missense probably benign
R8978:Ift122 UTSW 6 115925808 missense possibly damaging 0.78
R9149:Ift122 UTSW 6 115890531 missense probably damaging 1.00
Z1176:Ift122 UTSW 6 115915994 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAGAGCCAGCGTTAGATCAC -3'
(R):5'- AGCATGCTGTGAGTCTGAGG -3'

Sequencing Primer
(F):5'- AGCGTTAGATCACCACTGCTG -3'
(R):5'- TGTGAGTCTGAGGGCCACAG -3'
Posted On2015-08-18