Mutagenetix > Incidental Mutation

Incidental Mutation 'R4545:Ift122'

333714

Institutional Source

Beutler Lab

Gene Symbol

Ift122

Ensembl Gene

ENSMUSG00000030323

Gene Name

intraflagellar transport 122

Synonyms

C86139, sopb, Wdr10

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4545 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

115853470-115926699 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 115890588 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 433 (L433Q)

Ref Sequence

ENSEMBL: ENSMUSP00000045468 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038234] [ENSMUST00000112923] [ENSMUST00000112925] [ENSMUST00000141305]

AlphaFold

Q6NWV3

Predicted Effect

probably damaging
Transcript: ENSMUST00000038234
AA Change: L433Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000045468
Gene: ENSMUSG00000030323
AA Change: L433Q

Domain	Start	End	E-Value	Type
WD40	1	39	7.1e1	SMART
WD40	42	81	7.16e-10	SMART
WD40	83	120	1.54e0	SMART
WD40	122	160	1.43e0	SMART
WD40	162	208	2.29e1	SMART
WD40	210	249	1.91e1	SMART
WD40	251	290	3.45e-3	SMART
WD40	448	483	1.43e1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112923
AA Change: L492Q

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000108545
Gene: ENSMUSG00000030323
AA Change: L492Q

Domain	Start	End	E-Value	Type
WD40	1	39	7.1e1	SMART
WD40	42	81	7.16e-10	SMART
WD40	83	120	1.54e0	SMART
WD40	122	160	1.43e0	SMART
Blast:WD40	163	267	3e-46	BLAST
WD40	269	308	1.91e1	SMART
WD40	310	349	3.45e-3	SMART
WD40	507	542	1.43e1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112925
AA Change: L433Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000108547
Gene: ENSMUSG00000030323
AA Change: L433Q

Domain	Start	End	E-Value	Type
WD40	1	39	7.1e1	SMART
WD40	42	81	7.16e-10	SMART
WD40	83	120	1.54e0	SMART
WD40	122	160	1.43e0	SMART
WD40	162	208	2.29e1	SMART
WD40	210	249	1.91e1	SMART
WD40	251	290	3.45e-3	SMART
WD40	448	483	1.43e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138113

Predicted Effect

probably benign
Transcript: ENSMUST00000141305

SMART Domains

Protein: ENSMUSP00000138535
Gene: ENSMUSG00000030323

Domain	Start	End	E-Value	Type
WD40	1	39	7.1e1	SMART
WD40	42	81	7.16e-10	SMART
WD40	83	120	1.54e0	SMART
low complexity region	124	134	N/A	INTRINSIC
low complexity region	162	176	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146950

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149083

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152092

Meta Mutation Damage Score

0.7417

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

98% (41/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This cytoplasmic protein contains seven WD repeats and an AF-2 domain which function by recruiting coregulatory molecules and in transcriptional activation. Mutations in this gene cause cranioectodermal dysplasia-1. A related pseudogene is located on chromosome 3. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for a null mutation display embryonic lethality during organogenesis with exencephaly, a ventralized caudal neural tube, preaxial polydactyly, abnormal cilia, and left-right patterning defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akr1c20	A	C	13: 4,507,844	V201G	probably damaging	Het
Atf7	A	G	15: 102,534,327	V449A	probably benign	Het
Ccr1	G	A	9: 123,964,400	A31V	probably benign	Het
Chrna6	A	T	8: 27,406,683	S389T	probably benign	Het
Clic6	C	T	16: 92,492,157		probably benign	Het
Cmya5	G	A	13: 93,091,918	R2221*	probably null	Het
Coq8b	G	T	7: 27,233,505	C13F	probably benign	Het
Cspg4	T	A	9: 56,888,629	L1216Q	possibly damaging	Het
Decr1	C	A	4: 15,930,979	V118F	probably damaging	Het
Dlec1	A	T	9: 119,128,078	I796F	probably damaging	Het
Dnajc11	T	A	4: 151,979,941	D516E	probably damaging	Het
Dock8	G	A	19: 25,188,358	V1869M	probably damaging	Het
Dst	A	G	1: 34,188,738	D1982G	probably damaging	Het
Gm11808	C	T	4: 3,973,244	R106H	probably benign	Het
Gnptab	G	A	10: 88,414,595	D190N	probably benign	Het
Golga4	A	G	9: 118,556,845	K22E	probably damaging	Het
Hecw2	T	C	1: 53,813,222	*1579W	probably null	Het
Ica1l	A	G	1: 60,013,818		probably null	Het
Iqgap1	T	C	7: 80,762,567		probably null	Het
Klra13-ps	T	C	6: 130,291,269		noncoding transcript	Het
Mndal	A	T	1: 173,875,664	Y58*	probably null	Het
Mvb12b	G	C	2: 33,827,700	P172R	possibly damaging	Het
Ncapg	T	C	5: 45,671,212	F102L	probably damaging	Het
Olfr1447	T	A	19: 12,901,268	K171*	probably null	Het
Olfr235	T	C	19: 12,268,824	V198A	possibly damaging	Het
Olfr390	T	C	11: 73,787,166	V76A	probably damaging	Het
Pde8a	A	T	7: 81,328,099	R713S	probably damaging	Het
Rbks	T	C	5: 31,624,568	N296S	probably benign	Het
Sema3c	G	A	5: 17,694,772	V421I	probably benign	Het
Tm9sf1	A	G	14: 55,638,108	V393A	possibly damaging	Het
Tubgcp2	G	A	7: 139,996,071	P893L	possibly damaging	Het
Vnn3	G	A	10: 23,856,326	R158H	probably benign	Het
Zfa-ps	G	T	10: 52,544,936		noncoding transcript	Het
Zfp414	T	C	17: 33,631,648		probably benign	Het
Zfp810	G	A	9: 22,278,745	T289I	probably damaging	Het
Zfp819	G	T	7: 43,617,785	R488L	probably damaging	Het
Zfp942	C	T	17: 21,928,304	G448D	probably benign	Het
Zscan12	A	G	13: 21,366,705	K165E	possibly damaging	Het

Other mutations in Ift122

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Ift122	APN	6	115917057	missense	probably benign	0.10
IGL00783:Ift122	APN	6	115905902	missense	probably benign
IGL00784:Ift122	APN	6	115905902	missense	probably benign
IGL00799:Ift122	APN	6	115877536	missense	probably damaging	1.00
IGL00908:Ift122	APN	6	115913909	missense	probably benign	0.00
IGL01012:Ift122	APN	6	115899491	missense	probably damaging	0.99
IGL01444:Ift122	APN	6	115884379	missense	probably benign	0.08
IGL01451:Ift122	APN	6	115912604	critical splice donor site	probably null
IGL01940:Ift122	APN	6	115887371	splice site	probably benign
IGL02089:Ift122	APN	6	115925437	missense	probably benign	0.00
IGL02331:Ift122	APN	6	115887324	missense	probably damaging	1.00
IGL02929:Ift122	APN	6	115902877	missense	probably damaging	1.00
IGL03169:Ift122	APN	6	115905961	splice site	probably benign
PIT1430001:Ift122	UTSW	6	115925744	splice site	probably benign
R0158:Ift122	UTSW	6	115924484	splice site	probably benign
R0496:Ift122	UTSW	6	115905902	missense	probably benign
R1065:Ift122	UTSW	6	115875325	splice site	probably null
R1670:Ift122	UTSW	6	115923883	missense	probably benign	0.05
R1861:Ift122	UTSW	6	115891928	missense	probably damaging	1.00
R1889:Ift122	UTSW	6	115894421	critical splice donor site	probably null
R1990:Ift122	UTSW	6	115924367	missense	probably damaging	1.00
R2362:Ift122	UTSW	6	115884350	missense	probably damaging	0.99
R2385:Ift122	UTSW	6	115912522	missense	probably benign	0.21
R3734:Ift122	UTSW	6	115925501	splice site	probably benign
R3800:Ift122	UTSW	6	115925906	missense	probably benign	0.03
R3981:Ift122	UTSW	6	115913921	missense	probably benign	0.02
R4289:Ift122	UTSW	6	115923891	missense	probably damaging	1.00
R4546:Ift122	UTSW	6	115890588	missense	probably damaging	1.00
R4641:Ift122	UTSW	6	115888765	nonsense	probably null
R4815:Ift122	UTSW	6	115881556	missense	possibly damaging	0.95
R4854:Ift122	UTSW	6	115862746	missense	possibly damaging	0.61
R4928:Ift122	UTSW	6	115915858	utr 3 prime	probably benign
R5021:Ift122	UTSW	6	115864372	missense	probably benign	0.41
R5121:Ift122	UTSW	6	115912534	missense	probably benign	0.04
R5200:Ift122	UTSW	6	115920379	missense	probably damaging	0.99
R5549:Ift122	UTSW	6	115892022	missense	probably damaging	1.00
R6111:Ift122	UTSW	6	115875286	missense	probably damaging	1.00
R6141:Ift122	UTSW	6	115916011	missense	probably damaging	0.99
R6766:Ift122	UTSW	6	115926243	missense	probably benign	0.15
R7379:Ift122	UTSW	6	115926302	missense	probably benign
R7402:Ift122	UTSW	6	115894322	missense	probably benign	0.00
R7436:Ift122	UTSW	6	115926302	missense	probably benign
R7437:Ift122	UTSW	6	115926302	missense	probably benign
R7438:Ift122	UTSW	6	115926302	missense	probably benign
R7517:Ift122	UTSW	6	115890582	missense	probably benign	0.37
R7978:Ift122	UTSW	6	115920352	missense	probably benign	0.37
R8492:Ift122	UTSW	6	115887005	missense	probably benign	0.02
R8493:Ift122	UTSW	6	115910331	missense	probably benign	0.01
R8669:Ift122	UTSW	6	115923291	missense	probably damaging	0.98
R8867:Ift122	UTSW	6	115880671	missense	probably damaging	1.00
R8887:Ift122	UTSW	6	115891919	missense	probably benign	0.00
R8947:Ift122	UTSW	6	115924407	missense	probably benign
R8978:Ift122	UTSW	6	115925808	missense	possibly damaging	0.78
R9149:Ift122	UTSW	6	115890531	missense	probably damaging	1.00
R9571:Ift122	UTSW	6	115880667	missense	possibly damaging	0.50
R9573:Ift122	UTSW	6	115880685	missense	probably benign
R9677:Ift122	UTSW	6	115920396	missense	probably benign	0.16
Z1176:Ift122	UTSW	6	115915994	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAAGAGCCAGCGTTAGATCAC -3'
(R):5'- AGCATGCTGTGAGTCTGAGG -3'

Sequencing Primer
(F):5'- AGCGTTAGATCACCACTGCTG -3'
(R):5'- TGTGAGTCTGAGGGCCACAG -3'

Posted On

2015-08-18