Mutagenetix > Incidental Mutations

Incidental Mutation 'R4545:Coq8b'

333716

Institutional Source

Beutler Lab

Gene Symbol

Coq8b

Ensembl Gene

ENSMUSG00000003762

Gene Name

coenzyme Q8B

Synonyms

0610012P18Rik, Adck4

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4545 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27233023-27257950 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 27233505 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Phenylalanine at position 13 (C13F)

Ref Sequence

ENSEMBL: ENSMUSP00000123309 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003850] [ENSMUST00000003860] [ENSMUST00000108378] [ENSMUST00000128090]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000003850

SMART Domains

Protein: ENSMUSP00000003850
Gene: ENSMUSG00000003752

Domain	Start	End	E-Value	Type
low complexity region	28	59	N/A	INTRINSIC
low complexity region	346	363	N/A	INTRINSIC
Pfam:IPK	462	673	3.7e-42	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000003860
AA Change: C13F

PolyPhen 2 Score 0.316 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000003860
Gene: ENSMUSG00000003762
AA Change: C13F

Domain	Start	End	E-Value	Type
low complexity region	93	109	N/A	INTRINSIC
Pfam:ABC1	198	314	4.9e-34	PFAM
low complexity region	348	364	N/A	INTRINSIC
low complexity region	474	483	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108378
AA Change: C13F

PolyPhen 2 Score 0.316 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000104015
Gene: ENSMUSG00000003762
AA Change: C13F

Domain	Start	End	E-Value	Type
low complexity region	93	109	N/A	INTRINSIC
Pfam:ABC1	198	314	4.4e-34	PFAM
low complexity region	348	364	N/A	INTRINSIC
low complexity region	474	483	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000128090
AA Change: C13F

PolyPhen 2 Score 0.452 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000123309
Gene: ENSMUSG00000003762
AA Change: C13F

Domain	Start	End	E-Value	Type
low complexity region	93	109	N/A	INTRINSIC
Pfam:ABC1	198	304	3.4e-32	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206441

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

98% (41/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two copies of a domain found in protein kinases. The encoded protein has a complete protein kinase catalytic domain, and a truncated domain that contains only the active and binding sites of the protein kinase domain, however, it is not known whether the protein has any kinase activity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akr1c20	A	C	13: 4,507,844	V201G	probably damaging	Het
Atf7	A	G	15: 102,534,327	V449A	probably benign	Het
Ccr1	G	A	9: 123,964,400	A31V	probably benign	Het
Chrna6	A	T	8: 27,406,683	S389T	probably benign	Het
Clic6	C	T	16: 92,492,157		probably benign	Het
Cmya5	G	A	13: 93,091,918	R2221*	probably null	Het
Cspg4	T	A	9: 56,888,629	L1216Q	possibly damaging	Het
Decr1	C	A	4: 15,930,979	V118F	probably damaging	Het
Dlec1	A	T	9: 119,128,078	I796F	probably damaging	Het
Dnajc11	T	A	4: 151,979,941	D516E	probably damaging	Het
Dock8	G	A	19: 25,188,358	V1869M	probably damaging	Het
Dst	A	G	1: 34,188,738	D1982G	probably damaging	Het
Gm11808	C	T	4: 3,973,244	R106H	probably benign	Het
Gnptab	G	A	10: 88,414,595	D190N	probably benign	Het
Golga4	A	G	9: 118,556,845	K22E	probably damaging	Het
Hecw2	T	C	1: 53,813,222	*1579W	probably null	Het
Ica1l	A	G	1: 60,013,818		probably null	Het
Ift122	T	A	6: 115,890,588	L433Q	probably damaging	Het
Iqgap1	T	C	7: 80,762,567		probably null	Het
Klra13-ps	T	C	6: 130,291,269		noncoding transcript	Het
Mndal	A	T	1: 173,875,664	Y58*	probably null	Het
Mvb12b	G	C	2: 33,827,700	P172R	possibly damaging	Het
Ncapg	T	C	5: 45,671,212	F102L	probably damaging	Het
Olfr1447	T	A	19: 12,901,268	K171*	probably null	Het
Olfr235	T	C	19: 12,268,824	V198A	possibly damaging	Het
Olfr390	T	C	11: 73,787,166	V76A	probably damaging	Het
Pde8a	A	T	7: 81,328,099	R713S	probably damaging	Het
Rbks	T	C	5: 31,624,568	N296S	probably benign	Het
Sema3c	G	A	5: 17,694,772	V421I	probably benign	Het
Tm9sf1	A	G	14: 55,638,108	V393A	possibly damaging	Het
Tubgcp2	G	A	7: 139,996,071	P893L	possibly damaging	Het
Vnn3	G	A	10: 23,856,326	R158H	probably benign	Het
Zfa-ps	G	T	10: 52,544,936		noncoding transcript	Het
Zfp414	T	C	17: 33,631,648		probably benign	Het
Zfp810	G	A	9: 22,278,745	T289I	probably damaging	Het
Zfp819	G	T	7: 43,617,785	R488L	probably damaging	Het
Zfp942	C	T	17: 21,928,304	G448D	probably benign	Het
Zscan12	A	G	13: 21,366,705	K165E	possibly damaging	Het

Other mutations in Coq8b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00490:Coq8b	APN	7	27257477	missense	probably benign
IGL01116:Coq8b	APN	7	27239857	missense	possibly damaging	0.82
IGL01123:Coq8b	APN	7	27240084	missense	probably damaging	1.00
IGL02949:Coq8b	APN	7	27256613	missense	possibly damaging	0.70
R0067:Coq8b	UTSW	7	27233481	missense	possibly damaging	0.87
R0690:Coq8b	UTSW	7	27242249	missense	probably benign	0.15
R1307:Coq8b	UTSW	7	27250591	missense	probably damaging	1.00
R1470:Coq8b	UTSW	7	27252309	missense	probably benign	0.10
R1470:Coq8b	UTSW	7	27252309	missense	probably benign	0.10
R1551:Coq8b	UTSW	7	27257482	missense	probably damaging	1.00
R1682:Coq8b	UTSW	7	27240124	missense	probably benign	0.00
R1895:Coq8b	UTSW	7	27239874	missense	possibly damaging	0.91
R1945:Coq8b	UTSW	7	27233980	small insertion	probably benign
R1945:Coq8b	UTSW	7	27233981	small insertion	probably benign
R1946:Coq8b	UTSW	7	27239874	missense	possibly damaging	0.91
R2069:Coq8b	UTSW	7	27257377	missense	probably damaging	1.00
R3758:Coq8b	UTSW	7	27242227	nonsense	probably null
R4838:Coq8b	UTSW	7	27250591	missense	probably damaging	1.00
R5181:Coq8b	UTSW	7	27252322	missense	possibly damaging	0.65
R5345:Coq8b	UTSW	7	27250348	missense	probably benign
R5806:Coq8b	UTSW	7	27250625	nonsense	probably null
R5943:Coq8b	UTSW	7	27234003	missense	probably damaging	1.00
R6005:Coq8b	UTSW	7	27257325	nonsense	probably null
R7028:Coq8b	UTSW	7	27239868	missense	probably damaging	1.00
R7709:Coq8b	UTSW	7	27250537	missense	probably damaging	0.98
R8300:Coq8b	UTSW	7	27242246	missense	possibly damaging	0.72
R9039:Coq8b	UTSW	7	27250586	missense	probably benign	0.19
R9310:Coq8b	UTSW	7	27242061	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTTCTTAGCAACGTGGGC -3'
(R):5'- GCCAAGCAACTCCTACATGG -3'

Sequencing Primer
(F):5'- CTTTTCCAACAAGAGCGC -3'
(R):5'- TACATGGCCCCTGCAGAGAAG -3'

Posted On

2015-08-18