Incidental Mutation 'R4545:Zfp819'
ID 333717
Institutional Source Beutler Lab
Gene Symbol Zfp819
Ensembl Gene ENSMUSG00000055102
Gene Name zinc finger protein 819
Synonyms 4933405K07Rik, 4930427I11Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock # R4545 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 43607169-43618285 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 43617785 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 488 (R488L)
Ref Sequence ENSEMBL: ENSMUSP00000113867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032661] [ENSMUST00000116324] [ENSMUST00000120935]
AlphaFold Q80V81
Predicted Effect possibly damaging
Transcript: ENSMUST00000032661
AA Change: R564L

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000032661
Gene: ENSMUSG00000055102
AA Change: R564L

DomainStartEndE-ValueType
KRAB 27 85 1.69e-21 SMART
ZnF_C2H2 300 327 5.4e1 SMART
ZnF_C2H2 356 378 3.74e-5 SMART
ZnF_C2H2 384 406 5.59e-4 SMART
ZnF_C2H2 412 434 1.36e-2 SMART
ZnF_C2H2 440 462 7.78e-3 SMART
ZnF_C2H2 468 490 5.9e-3 SMART
ZnF_C2H2 496 518 1.2e-3 SMART
ZnF_C2H2 524 546 4.79e-3 SMART
ZnF_C2H2 552 574 4.54e-4 SMART
ZnF_C2H2 580 602 3.11e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000116324
AA Change: R564L

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112026
Gene: ENSMUSG00000055102
AA Change: R564L

DomainStartEndE-ValueType
KRAB 27 85 1.69e-21 SMART
ZnF_C2H2 300 327 5.4e1 SMART
ZnF_C2H2 356 378 3.74e-5 SMART
ZnF_C2H2 384 406 5.59e-4 SMART
ZnF_C2H2 412 434 1.36e-2 SMART
ZnF_C2H2 440 462 7.78e-3 SMART
ZnF_C2H2 468 490 5.9e-3 SMART
ZnF_C2H2 496 518 1.2e-3 SMART
ZnF_C2H2 524 546 4.79e-3 SMART
ZnF_C2H2 552 574 4.54e-4 SMART
ZnF_C2H2 580 602 3.11e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120935
AA Change: R488L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113867
Gene: ENSMUSG00000055102
AA Change: R488L

DomainStartEndE-ValueType
ZnF_C2H2 224 251 5.4e1 SMART
ZnF_C2H2 280 302 3.74e-5 SMART
ZnF_C2H2 308 330 5.59e-4 SMART
ZnF_C2H2 336 358 1.36e-2 SMART
ZnF_C2H2 364 386 7.78e-3 SMART
ZnF_C2H2 392 414 5.9e-3 SMART
ZnF_C2H2 420 442 1.2e-3 SMART
ZnF_C2H2 448 470 4.79e-3 SMART
ZnF_C2H2 476 498 4.54e-4 SMART
ZnF_C2H2 504 526 3.11e-2 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Atf7 A G 15: 102,534,327 V449A probably benign Het
Ccr1 G A 9: 123,964,400 A31V probably benign Het
Chrna6 A T 8: 27,406,683 S389T probably benign Het
Clic6 C T 16: 92,492,157 probably benign Het
Cmya5 G A 13: 93,091,918 R2221* probably null Het
Coq8b G T 7: 27,233,505 C13F probably benign Het
Cspg4 T A 9: 56,888,629 L1216Q possibly damaging Het
Decr1 C A 4: 15,930,979 V118F probably damaging Het
Dlec1 A T 9: 119,128,078 I796F probably damaging Het
Dnajc11 T A 4: 151,979,941 D516E probably damaging Het
Dock8 G A 19: 25,188,358 V1869M probably damaging Het
Dst A G 1: 34,188,738 D1982G probably damaging Het
Gm11808 C T 4: 3,973,244 R106H probably benign Het
Gnptab G A 10: 88,414,595 D190N probably benign Het
Golga4 A G 9: 118,556,845 K22E probably damaging Het
Hecw2 T C 1: 53,813,222 *1579W probably null Het
Ica1l A G 1: 60,013,818 probably null Het
Ift122 T A 6: 115,890,588 L433Q probably damaging Het
Iqgap1 T C 7: 80,762,567 probably null Het
Klra13-ps T C 6: 130,291,269 noncoding transcript Het
Mndal A T 1: 173,875,664 Y58* probably null Het
Mvb12b G C 2: 33,827,700 P172R possibly damaging Het
Ncapg T C 5: 45,671,212 F102L probably damaging Het
Olfr1447 T A 19: 12,901,268 K171* probably null Het
Olfr235 T C 19: 12,268,824 V198A possibly damaging Het
Olfr390 T C 11: 73,787,166 V76A probably damaging Het
Pde8a A T 7: 81,328,099 R713S probably damaging Het
Rbks T C 5: 31,624,568 N296S probably benign Het
Sema3c G A 5: 17,694,772 V421I probably benign Het
Tm9sf1 A G 14: 55,638,108 V393A possibly damaging Het
Tubgcp2 G A 7: 139,996,071 P893L possibly damaging Het
Vnn3 G A 10: 23,856,326 R158H probably benign Het
Zfa-ps G T 10: 52,544,936 noncoding transcript Het
Zfp414 T C 17: 33,631,648 probably benign Het
Zfp810 G A 9: 22,278,745 T289I probably damaging Het
Zfp942 C T 17: 21,928,304 G448D probably benign Het
Zscan12 A G 13: 21,366,705 K165E possibly damaging Het
Other mutations in Zfp819
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Zfp819 APN 7 43611979 splice site probably benign
IGL01732:Zfp819 APN 7 43616422 missense probably benign 0.13
IGL02139:Zfp819 APN 7 43612110 critical splice donor site probably null
IGL02276:Zfp819 APN 7 43612004 missense possibly damaging 0.84
R0306:Zfp819 UTSW 7 43617197 missense possibly damaging 0.92
R0620:Zfp819 UTSW 7 43616444 missense probably benign 0.07
R1301:Zfp819 UTSW 7 43617100 missense possibly damaging 0.94
R1314:Zfp819 UTSW 7 43617056 missense probably benign 0.27
R1980:Zfp819 UTSW 7 43616461 missense probably benign
R4993:Zfp819 UTSW 7 43617296 missense probably benign 0.37
R5053:Zfp819 UTSW 7 43617146 missense probably damaging 1.00
R6080:Zfp819 UTSW 7 43616696 missense probably benign 0.00
R7289:Zfp819 UTSW 7 43617082 missense probably damaging 1.00
R7387:Zfp819 UTSW 7 43612641 critical splice donor site probably null
R7608:Zfp819 UTSW 7 43616933 missense probably benign
R7813:Zfp819 UTSW 7 43616767 missense probably benign
R7863:Zfp819 UTSW 7 43617892 missense probably benign 0.17
R8026:Zfp819 UTSW 7 43617895 missense probably benign 0.44
R8080:Zfp819 UTSW 7 43617724 missense probably damaging 1.00
R9072:Zfp819 UTSW 7 43617146 missense probably damaging 1.00
R9073:Zfp819 UTSW 7 43617146 missense probably damaging 1.00
R9199:Zfp819 UTSW 7 43617779 missense probably benign 0.04
R9792:Zfp819 UTSW 7 43612095 missense possibly damaging 0.93
Z1176:Zfp819 UTSW 7 43617687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCGGGAAATTGTTTGTC -3'
(R):5'- ACGTATGAGCAAACAACTGC -3'

Sequencing Primer
(F):5'- GAAGCCTTATGAATGCCCTGACTG -3'
(R):5'- GTATGAGCAAACAACTGCACACAAC -3'
Posted On 2015-08-18