Incidental Mutation 'R4545:Zfp819'
ID 333717
Institutional Source Beutler Lab
Gene Symbol Zfp819
Ensembl Gene ENSMUSG00000055102
Gene Name zinc finger protein 819
Synonyms 4933405K07Rik, 4930427I11Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.102) question?
Stock # R4545 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 43256593-43267709 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 43267209 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 488 (R488L)
Ref Sequence ENSEMBL: ENSMUSP00000113867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032661] [ENSMUST00000116324] [ENSMUST00000120935]
AlphaFold Q80V81
Predicted Effect possibly damaging
Transcript: ENSMUST00000032661
AA Change: R564L

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000032661
Gene: ENSMUSG00000055102
AA Change: R564L

DomainStartEndE-ValueType
KRAB 27 85 1.69e-21 SMART
ZnF_C2H2 300 327 5.4e1 SMART
ZnF_C2H2 356 378 3.74e-5 SMART
ZnF_C2H2 384 406 5.59e-4 SMART
ZnF_C2H2 412 434 1.36e-2 SMART
ZnF_C2H2 440 462 7.78e-3 SMART
ZnF_C2H2 468 490 5.9e-3 SMART
ZnF_C2H2 496 518 1.2e-3 SMART
ZnF_C2H2 524 546 4.79e-3 SMART
ZnF_C2H2 552 574 4.54e-4 SMART
ZnF_C2H2 580 602 3.11e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000116324
AA Change: R564L

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112026
Gene: ENSMUSG00000055102
AA Change: R564L

DomainStartEndE-ValueType
KRAB 27 85 1.69e-21 SMART
ZnF_C2H2 300 327 5.4e1 SMART
ZnF_C2H2 356 378 3.74e-5 SMART
ZnF_C2H2 384 406 5.59e-4 SMART
ZnF_C2H2 412 434 1.36e-2 SMART
ZnF_C2H2 440 462 7.78e-3 SMART
ZnF_C2H2 468 490 5.9e-3 SMART
ZnF_C2H2 496 518 1.2e-3 SMART
ZnF_C2H2 524 546 4.79e-3 SMART
ZnF_C2H2 552 574 4.54e-4 SMART
ZnF_C2H2 580 602 3.11e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120935
AA Change: R488L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113867
Gene: ENSMUSG00000055102
AA Change: R488L

DomainStartEndE-ValueType
ZnF_C2H2 224 251 5.4e1 SMART
ZnF_C2H2 280 302 3.74e-5 SMART
ZnF_C2H2 308 330 5.59e-4 SMART
ZnF_C2H2 336 358 1.36e-2 SMART
ZnF_C2H2 364 386 7.78e-3 SMART
ZnF_C2H2 392 414 5.9e-3 SMART
ZnF_C2H2 420 442 1.2e-3 SMART
ZnF_C2H2 448 470 4.79e-3 SMART
ZnF_C2H2 476 498 4.54e-4 SMART
ZnF_C2H2 504 526 3.11e-2 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 A C 13: 4,557,843 (GRCm39) V201G probably damaging Het
Atf7 A G 15: 102,442,762 (GRCm39) V449A probably benign Het
Ccr1 G A 9: 123,764,437 (GRCm39) A31V probably benign Het
Chrna6 A T 8: 27,896,711 (GRCm39) S389T probably benign Het
Clic6 C T 16: 92,289,045 (GRCm39) probably benign Het
Cmya5 G A 13: 93,228,426 (GRCm39) R2221* probably null Het
Coq8b G T 7: 26,932,930 (GRCm39) C13F probably benign Het
Cspg4 T A 9: 56,795,913 (GRCm39) L1216Q possibly damaging Het
Decr1 C A 4: 15,930,979 (GRCm39) V118F probably damaging Het
Dlec1 A T 9: 118,957,146 (GRCm39) I796F probably damaging Het
Dnajc11 T A 4: 152,064,398 (GRCm39) D516E probably damaging Het
Dock8 G A 19: 25,165,722 (GRCm39) V1869M probably damaging Het
Dst A G 1: 34,227,819 (GRCm39) D1982G probably damaging Het
Gnptab G A 10: 88,250,457 (GRCm39) D190N probably benign Het
Golga4 A G 9: 118,385,913 (GRCm39) K22E probably damaging Het
Hecw2 T C 1: 53,852,381 (GRCm39) *1579W probably null Het
Ica1l A G 1: 60,052,977 (GRCm39) probably null Het
Ift122 T A 6: 115,867,549 (GRCm39) L433Q probably damaging Het
Iqgap1 T C 7: 80,412,315 (GRCm39) probably null Het
Klra13-ps T C 6: 130,268,232 (GRCm39) noncoding transcript Het
Mndal A T 1: 173,703,230 (GRCm39) Y58* probably null Het
Mvb12b G C 2: 33,717,712 (GRCm39) P172R possibly damaging Het
Ncapg T C 5: 45,828,554 (GRCm39) F102L probably damaging Het
Or1e30 T C 11: 73,677,992 (GRCm39) V76A probably damaging Het
Or5an11 T C 19: 12,246,188 (GRCm39) V198A possibly damaging Het
Or5b97 T A 19: 12,878,632 (GRCm39) K171* probably null Het
Pde8a A T 7: 80,977,847 (GRCm39) R713S probably damaging Het
Rbks T C 5: 31,781,912 (GRCm39) N296S probably benign Het
Sema3c G A 5: 17,899,770 (GRCm39) V421I probably benign Het
Tm9sf1 A G 14: 55,875,565 (GRCm39) V393A possibly damaging Het
Tubgcp2 G A 7: 139,575,984 (GRCm39) P893L possibly damaging Het
Uba52rt C T 4: 3,973,244 (GRCm39) R106H probably benign Het
Vnn3 G A 10: 23,732,224 (GRCm39) R158H probably benign Het
Zfa-ps G T 10: 52,421,032 (GRCm39) noncoding transcript Het
Zfp414 T C 17: 33,850,622 (GRCm39) probably benign Het
Zfp810 G A 9: 22,190,041 (GRCm39) T289I probably damaging Het
Zfp942 C T 17: 22,147,285 (GRCm39) G448D probably benign Het
Zscan12 A G 13: 21,550,875 (GRCm39) K165E possibly damaging Het
Other mutations in Zfp819
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Zfp819 APN 7 43,261,403 (GRCm39) splice site probably benign
IGL01732:Zfp819 APN 7 43,265,846 (GRCm39) missense probably benign 0.13
IGL02139:Zfp819 APN 7 43,261,534 (GRCm39) critical splice donor site probably null
IGL02276:Zfp819 APN 7 43,261,428 (GRCm39) missense possibly damaging 0.84
R0306:Zfp819 UTSW 7 43,266,621 (GRCm39) missense possibly damaging 0.92
R0620:Zfp819 UTSW 7 43,265,868 (GRCm39) missense probably benign 0.07
R1301:Zfp819 UTSW 7 43,266,524 (GRCm39) missense possibly damaging 0.94
R1314:Zfp819 UTSW 7 43,266,480 (GRCm39) missense probably benign 0.27
R1980:Zfp819 UTSW 7 43,265,885 (GRCm39) missense probably benign
R4993:Zfp819 UTSW 7 43,266,720 (GRCm39) missense probably benign 0.37
R5053:Zfp819 UTSW 7 43,266,570 (GRCm39) missense probably damaging 1.00
R6080:Zfp819 UTSW 7 43,266,120 (GRCm39) missense probably benign 0.00
R7289:Zfp819 UTSW 7 43,266,506 (GRCm39) missense probably damaging 1.00
R7387:Zfp819 UTSW 7 43,262,065 (GRCm39) critical splice donor site probably null
R7608:Zfp819 UTSW 7 43,266,357 (GRCm39) missense probably benign
R7813:Zfp819 UTSW 7 43,266,191 (GRCm39) missense probably benign
R7863:Zfp819 UTSW 7 43,267,316 (GRCm39) missense probably benign 0.17
R8026:Zfp819 UTSW 7 43,267,319 (GRCm39) missense probably benign 0.44
R8080:Zfp819 UTSW 7 43,267,148 (GRCm39) missense probably damaging 1.00
R9072:Zfp819 UTSW 7 43,266,570 (GRCm39) missense probably damaging 1.00
R9073:Zfp819 UTSW 7 43,266,570 (GRCm39) missense probably damaging 1.00
R9199:Zfp819 UTSW 7 43,267,203 (GRCm39) missense probably benign 0.04
R9792:Zfp819 UTSW 7 43,261,519 (GRCm39) missense possibly damaging 0.93
Z1176:Zfp819 UTSW 7 43,267,111 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCGGGAAATTGTTTGTC -3'
(R):5'- ACGTATGAGCAAACAACTGC -3'

Sequencing Primer
(F):5'- GAAGCCTTATGAATGCCCTGACTG -3'
(R):5'- GTATGAGCAAACAACTGCACACAAC -3'
Posted On 2015-08-18