Incidental Mutation 'R4545:Zfp819'
ID333717
Institutional Source Beutler Lab
Gene Symbol Zfp819
Ensembl Gene ENSMUSG00000055102
Gene Namezinc finger protein 819
Synonyms4933405K07Rik, 4930427I11Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R4545 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location43607169-43618285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 43617785 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 488 (R488L)
Ref Sequence ENSEMBL: ENSMUSP00000113867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032661] [ENSMUST00000116324] [ENSMUST00000120935]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032661
AA Change: R564L

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000032661
Gene: ENSMUSG00000055102
AA Change: R564L

DomainStartEndE-ValueType
KRAB 27 85 1.69e-21 SMART
ZnF_C2H2 300 327 5.4e1 SMART
ZnF_C2H2 356 378 3.74e-5 SMART
ZnF_C2H2 384 406 5.59e-4 SMART
ZnF_C2H2 412 434 1.36e-2 SMART
ZnF_C2H2 440 462 7.78e-3 SMART
ZnF_C2H2 468 490 5.9e-3 SMART
ZnF_C2H2 496 518 1.2e-3 SMART
ZnF_C2H2 524 546 4.79e-3 SMART
ZnF_C2H2 552 574 4.54e-4 SMART
ZnF_C2H2 580 602 3.11e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000116324
AA Change: R564L

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112026
Gene: ENSMUSG00000055102
AA Change: R564L

DomainStartEndE-ValueType
KRAB 27 85 1.69e-21 SMART
ZnF_C2H2 300 327 5.4e1 SMART
ZnF_C2H2 356 378 3.74e-5 SMART
ZnF_C2H2 384 406 5.59e-4 SMART
ZnF_C2H2 412 434 1.36e-2 SMART
ZnF_C2H2 440 462 7.78e-3 SMART
ZnF_C2H2 468 490 5.9e-3 SMART
ZnF_C2H2 496 518 1.2e-3 SMART
ZnF_C2H2 524 546 4.79e-3 SMART
ZnF_C2H2 552 574 4.54e-4 SMART
ZnF_C2H2 580 602 3.11e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120935
AA Change: R488L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113867
Gene: ENSMUSG00000055102
AA Change: R488L

DomainStartEndE-ValueType
ZnF_C2H2 224 251 5.4e1 SMART
ZnF_C2H2 280 302 3.74e-5 SMART
ZnF_C2H2 308 330 5.59e-4 SMART
ZnF_C2H2 336 358 1.36e-2 SMART
ZnF_C2H2 364 386 7.78e-3 SMART
ZnF_C2H2 392 414 5.9e-3 SMART
ZnF_C2H2 420 442 1.2e-3 SMART
ZnF_C2H2 448 470 4.79e-3 SMART
ZnF_C2H2 476 498 4.54e-4 SMART
ZnF_C2H2 504 526 3.11e-2 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Atf7 A G 15: 102,534,327 V449A probably benign Het
Ccr1 G A 9: 123,964,400 A31V probably benign Het
Chrna6 A T 8: 27,406,683 S389T probably benign Het
Clic6 C T 16: 92,492,157 probably benign Het
Cmya5 G A 13: 93,091,918 R2221* probably null Het
Coq8b G T 7: 27,233,505 C13F probably benign Het
Cspg4 T A 9: 56,888,629 L1216Q possibly damaging Het
Decr1 C A 4: 15,930,979 V118F probably damaging Het
Dlec1 A T 9: 119,128,078 I796F probably damaging Het
Dnajc11 T A 4: 151,979,941 D516E probably damaging Het
Dock8 G A 19: 25,188,358 V1869M probably damaging Het
Dst A G 1: 34,188,738 D1982G probably damaging Het
Gm11808 C T 4: 3,973,244 R106H probably benign Het
Gnptab G A 10: 88,414,595 D190N probably benign Het
Golga4 A G 9: 118,556,845 K22E probably damaging Het
Hecw2 T C 1: 53,813,222 *1579W probably null Het
Ica1l A G 1: 60,013,818 probably null Het
Ift122 T A 6: 115,890,588 L433Q probably damaging Het
Iqgap1 T C 7: 80,762,567 probably null Het
Klra13-ps T C 6: 130,291,269 noncoding transcript Het
Mndal A T 1: 173,875,664 Y58* probably null Het
Mvb12b G C 2: 33,827,700 P172R possibly damaging Het
Ncapg T C 5: 45,671,212 F102L probably damaging Het
Olfr1447 T A 19: 12,901,268 K171* probably null Het
Olfr235 T C 19: 12,268,824 V198A possibly damaging Het
Olfr390 T C 11: 73,787,166 V76A probably damaging Het
Pde8a A T 7: 81,328,099 R713S probably damaging Het
Rbks T C 5: 31,624,568 N296S probably benign Het
Sema3c G A 5: 17,694,772 V421I probably benign Het
Tm9sf1 A G 14: 55,638,108 V393A possibly damaging Het
Tubgcp2 G A 7: 139,996,071 P893L possibly damaging Het
Vnn3 G A 10: 23,856,326 R158H probably benign Het
Zfa-ps G T 10: 52,544,936 noncoding transcript Het
Zfp414 T C 17: 33,631,648 probably benign Het
Zfp810 G A 9: 22,278,745 T289I probably damaging Het
Zfp942 C T 17: 21,928,304 G448D probably benign Het
Zscan12 A G 13: 21,366,705 K165E possibly damaging Het
Other mutations in Zfp819
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Zfp819 APN 7 43611979 splice site probably benign
IGL01732:Zfp819 APN 7 43616422 missense probably benign 0.13
IGL02139:Zfp819 APN 7 43612110 critical splice donor site probably null
IGL02276:Zfp819 APN 7 43612004 missense possibly damaging 0.84
R0306:Zfp819 UTSW 7 43617197 missense possibly damaging 0.92
R0620:Zfp819 UTSW 7 43616444 missense probably benign 0.07
R1301:Zfp819 UTSW 7 43617100 missense possibly damaging 0.94
R1314:Zfp819 UTSW 7 43617056 missense probably benign 0.27
R1980:Zfp819 UTSW 7 43616461 missense probably benign
R4993:Zfp819 UTSW 7 43617296 missense probably benign 0.37
R5053:Zfp819 UTSW 7 43617146 missense probably damaging 1.00
R6080:Zfp819 UTSW 7 43616696 missense probably benign 0.00
R7289:Zfp819 UTSW 7 43617082 missense probably damaging 1.00
R7387:Zfp819 UTSW 7 43612641 critical splice donor site probably null
R7608:Zfp819 UTSW 7 43616933 missense probably benign
R7813:Zfp819 UTSW 7 43616767 missense probably benign
R7863:Zfp819 UTSW 7 43617892 missense probably benign 0.17
R8026:Zfp819 UTSW 7 43617895 missense probably benign 0.44
R8080:Zfp819 UTSW 7 43617724 missense probably damaging 1.00
Z1176:Zfp819 UTSW 7 43617687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCGGGAAATTGTTTGTC -3'
(R):5'- ACGTATGAGCAAACAACTGC -3'

Sequencing Primer
(F):5'- GAAGCCTTATGAATGCCCTGACTG -3'
(R):5'- GTATGAGCAAACAACTGCACACAAC -3'
Posted On2015-08-18