Mutagenetix > Incidental Mutations

Incidental Mutation 'R4545:Iqgap1'

333718

Institutional Source

Beutler Lab

Gene Symbol

Iqgap1

Ensembl Gene

ENSMUSG00000030536

Gene Name

IQ motif containing GTPase activating protein 1

Synonyms

D7Ertd237e, D7Ertd257e

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4545 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80711583-80825974 bp(-) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

T to C at 80762567 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000145556 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167377] [ENSMUST00000167377] [ENSMUST00000205813] [ENSMUST00000205813]

Predicted Effect

probably null
Transcript: ENSMUST00000167377

SMART Domains

Protein: ENSMUSP00000128278
Gene: ENSMUSG00000030536

Domain	Start	End	E-Value	Type
CH	46	155	2.02e-20	SMART
internal_repeat_1	203	278	3.71e-8	PROSPERO
low complexity region	324	335	N/A	INTRINSIC
low complexity region	390	399	N/A	INTRINSIC
coiled coil region	488	515	N/A	INTRINSIC
internal_repeat_1	608	684	3.71e-8	PROSPERO
IQ	744	766	3.85e-3	SMART
IQ	774	796	1.12e-4	SMART
IQ	804	826	1.32e-1	SMART
IQ	834	856	1.15e1	SMART
coiled coil region	886	914	N/A	INTRINSIC
RasGAP	992	1345	7.46e-89	SMART
Pfam:RasGAP_C	1452	1580	4.5e-41	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000167377

SMART Domains

Protein: ENSMUSP00000128278
Gene: ENSMUSG00000030536

Domain	Start	End	E-Value	Type
CH	46	155	2.02e-20	SMART
internal_repeat_1	203	278	3.71e-8	PROSPERO
low complexity region	324	335	N/A	INTRINSIC
low complexity region	390	399	N/A	INTRINSIC
coiled coil region	488	515	N/A	INTRINSIC
internal_repeat_1	608	684	3.71e-8	PROSPERO
IQ	744	766	3.85e-3	SMART
IQ	774	796	1.12e-4	SMART
IQ	804	826	1.32e-1	SMART
IQ	834	856	1.15e1	SMART
coiled coil region	886	914	N/A	INTRINSIC
RasGAP	992	1345	7.46e-89	SMART
Pfam:RasGAP_C	1452	1580	4.5e-41	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000205813

Predicted Effect

probably null
Transcript: ENSMUST00000205813

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205824

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206149

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206896

Meta Mutation Damage Score

0.9588

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

98% (41/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IQGAP family. The protein contains four IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. Expression of the protein is upregulated by gene amplification in two gastric cancer cell lines. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null allele exhibit a late-onset gastric hyperplasia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akr1c20	A	C	13: 4,507,844	V201G	probably damaging	Het
Atf7	A	G	15: 102,534,327	V449A	probably benign	Het
Ccr1	G	A	9: 123,964,400	A31V	probably benign	Het
Chrna6	A	T	8: 27,406,683	S389T	probably benign	Het
Clic6	C	T	16: 92,492,157		probably benign	Het
Cmya5	G	A	13: 93,091,918	R2221*	probably null	Het
Coq8b	G	T	7: 27,233,505	C13F	probably benign	Het
Cspg4	T	A	9: 56,888,629	L1216Q	possibly damaging	Het
Decr1	C	A	4: 15,930,979	V118F	probably damaging	Het
Dlec1	A	T	9: 119,128,078	I796F	probably damaging	Het
Dnajc11	T	A	4: 151,979,941	D516E	probably damaging	Het
Dock8	G	A	19: 25,188,358	V1869M	probably damaging	Het
Dst	A	G	1: 34,188,738	D1982G	probably damaging	Het
Gm11808	C	T	4: 3,973,244	R106H	probably benign	Het
Gnptab	G	A	10: 88,414,595	D190N	probably benign	Het
Golga4	A	G	9: 118,556,845	K22E	probably damaging	Het
Hecw2	T	C	1: 53,813,222	*1579W	probably null	Het
Ica1l	A	G	1: 60,013,818		probably null	Het
Ift122	T	A	6: 115,890,588	L433Q	probably damaging	Het
Klra13-ps	T	C	6: 130,291,269		noncoding transcript	Het
Mndal	A	T	1: 173,875,664	Y58*	probably null	Het
Mvb12b	G	C	2: 33,827,700	P172R	possibly damaging	Het
Ncapg	T	C	5: 45,671,212	F102L	probably damaging	Het
Olfr1447	T	A	19: 12,901,268	K171*	probably null	Het
Olfr235	T	C	19: 12,268,824	V198A	possibly damaging	Het
Olfr390	T	C	11: 73,787,166	V76A	probably damaging	Het
Pde8a	A	T	7: 81,328,099	R713S	probably damaging	Het
Rbks	T	C	5: 31,624,568	N296S	probably benign	Het
Sema3c	G	A	5: 17,694,772	V421I	probably benign	Het
Tm9sf1	A	G	14: 55,638,108	V393A	possibly damaging	Het
Tubgcp2	G	A	7: 139,996,071	P893L	possibly damaging	Het
Vnn3	G	A	10: 23,856,326	R158H	probably benign	Het
Zfa-ps	G	T	10: 52,544,936		noncoding transcript	Het
Zfp414	T	C	17: 33,631,648		probably benign	Het
Zfp810	G	A	9: 22,278,745	T289I	probably damaging	Het
Zfp819	G	T	7: 43,617,785	R488L	probably damaging	Het
Zfp942	C	T	17: 21,928,304	G448D	probably benign	Het
Zscan12	A	G	13: 21,366,705	K165E	possibly damaging	Het

Other mutations in Iqgap1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Iqgap1	APN	7	80759844	missense	probably benign	0.00
IGL00984:Iqgap1	APN	7	80726798	missense	probably damaging	1.00
IGL01570:Iqgap1	APN	7	80723061	missense	possibly damaging	0.76
IGL01738:Iqgap1	APN	7	80723900	missense	possibly damaging	0.80
IGL02141:Iqgap1	APN	7	80738121	missense	probably damaging	1.00
IGL02336:Iqgap1	APN	7	80752293	missense	probably benign	0.39
IGL02416:Iqgap1	APN	7	80726038	missense	probably damaging	1.00
IGL02597:Iqgap1	APN	7	80723885	missense	probably damaging	1.00
IGL02662:Iqgap1	APN	7	80743079	missense	probably benign
IGL03157:Iqgap1	APN	7	80751888	missense	probably benign	0.34
IGL03189:Iqgap1	APN	7	80713842	missense	probably benign	0.12
IGL03216:Iqgap1	APN	7	80743088	missense	probably benign	0.33
R0024:Iqgap1	UTSW	7	80751939	missense	probably benign
R0126:Iqgap1	UTSW	7	80738322	missense	probably benign	0.00
R0144:Iqgap1	UTSW	7	80751920	missense	probably damaging	1.00
R0325:Iqgap1	UTSW	7	80751930	missense	probably benign	0.01
R0376:Iqgap1	UTSW	7	80723879	missense	probably benign	0.01
R0650:Iqgap1	UTSW	7	80736395	missense	probably damaging	1.00
R0652:Iqgap1	UTSW	7	80736395	missense	probably damaging	1.00
R0741:Iqgap1	UTSW	7	80720987	missense	probably benign	0.03
R0751:Iqgap1	UTSW	7	80725573	unclassified	probably benign
R1067:Iqgap1	UTSW	7	80723828	missense	probably benign	0.01
R1389:Iqgap1	UTSW	7	80759756	critical splice donor site	probably null
R1473:Iqgap1	UTSW	7	80734011	missense	probably benign	0.00
R1613:Iqgap1	UTSW	7	80768457	missense	probably damaging	1.00
R1842:Iqgap1	UTSW	7	80760883	missense	probably damaging	1.00
R1909:Iqgap1	UTSW	7	80743828	missense	probably benign
R2062:Iqgap1	UTSW	7	80723979	nonsense	probably null
R2149:Iqgap1	UTSW	7	80762560	missense	probably damaging	1.00
R2153:Iqgap1	UTSW	7	80751953	missense	probably benign	0.00
R2153:Iqgap1	UTSW	7	80759903	missense	possibly damaging	0.55
R3160:Iqgap1	UTSW	7	80752338	missense	probably benign
R3162:Iqgap1	UTSW	7	80752338	missense	probably benign
R3605:Iqgap1	UTSW	7	80723789	missense	probably benign	0.02
R3709:Iqgap1	UTSW	7	80717087	missense	possibly damaging	0.87
R3935:Iqgap1	UTSW	7	80743837	missense	possibly damaging	0.54
R3979:Iqgap1	UTSW	7	80759934	missense	probably damaging	0.98
R4787:Iqgap1	UTSW	7	80735513	missense	probably damaging	1.00
R4925:Iqgap1	UTSW	7	80765317	missense	probably damaging	1.00
R4953:Iqgap1	UTSW	7	80723776	splice site	probably null
R5037:Iqgap1	UTSW	7	80734100	missense	probably damaging	1.00
R5158:Iqgap1	UTSW	7	80743068	missense	probably benign	0.02
R5183:Iqgap1	UTSW	7	80723065	missense	probably damaging	1.00
R5262:Iqgap1	UTSW	7	80726742	missense	probably benign	0.00
R5271:Iqgap1	UTSW	7	80734148	missense	probably damaging	1.00
R5289:Iqgap1	UTSW	7	80738724	missense	possibly damaging	0.88
R5359:Iqgap1	UTSW	7	80766959	missense	probably benign	0.00
R5423:Iqgap1	UTSW	7	80799862	missense	probably damaging	1.00
R5843:Iqgap1	UTSW	7	80726080	missense	probably benign	0.03
R5849:Iqgap1	UTSW	7	80803158	missense	probably benign
R6164:Iqgap1	UTSW	7	80809106	missense	unknown
R6315:Iqgap1	UTSW	7	80799890	missense	possibly damaging	0.65
R6335:Iqgap1	UTSW	7	80728024	missense	probably damaging	1.00
R6488:Iqgap1	UTSW	7	80730326	missense	probably benign	0.00
R6723:Iqgap1	UTSW	7	80723822	missense	probably benign	0.01
R6800:Iqgap1	UTSW	7	80728981	missense	possibly damaging	0.56
R6815:Iqgap1	UTSW	7	80766884	critical splice donor site	probably null
R7240:Iqgap1	UTSW	7	80759839	missense	probably benign	0.22
R7386:Iqgap1	UTSW	7	80726042	missense	probably damaging	1.00
R7387:Iqgap1	UTSW	7	80720990	missense	probably benign	0.03
R7410:Iqgap1	UTSW	7	80723030	nonsense	probably null
R7429:Iqgap1	UTSW	7	80751440	missense	probably benign	0.00
R7452:Iqgap1	UTSW	7	80760829	missense	possibly damaging	0.80
R7615:Iqgap1	UTSW	7	80730100	missense	probably damaging	1.00
R7615:Iqgap1	UTSW	7	80751346	missense	probably benign
R7726:Iqgap1	UTSW	7	80757456	missense	probably benign	0.37
R7783:Iqgap1	UTSW	7	80809059	missense	probably benign	0.01
R7785:Iqgap1	UTSW	7	80738169	missense	probably damaging	1.00
RF004:Iqgap1	UTSW	7	80720875	missense	probably benign
RF063:Iqgap1	UTSW	7	80723751	frame shift	probably null
X0064:Iqgap1	UTSW	7	80720931	nonsense	probably null
X0067:Iqgap1	UTSW	7	80766903	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CACTGACAAGGGCAGATCAC -3'
(R):5'- ACTGGGACATGAAATTCCAGCC -3'

Sequencing Primer
(F):5'- CAAGGGCAGATCACTTATGTTCCG -3'
(R):5'- TCCAGCCTAAGGGAAATCTTTC -3'

Posted On

2015-08-18