Incidental Mutation 'R4545:Pde8a'
ID333719
Institutional Source Beutler Lab
Gene Symbol Pde8a
Ensembl Gene ENSMUSG00000025584
Gene Namephosphodiesterase 8A
SynonymsPde8
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4545 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location81213596-81334533 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 81328099 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 713 (R713S)
Ref Sequence ENSEMBL: ENSMUSP00000026672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026672]
AlphaFold O88502
Predicted Effect probably damaging
Transcript: ENSMUST00000026672
AA Change: R713S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026672
Gene: ENSMUSG00000025584
AA Change: R713S

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
Blast:REC 79 194 2e-48 BLAST
PAS 211 277 2.18e-2 SMART
Blast:HDc 403 451 4e-11 BLAST
HDc 548 734 5.78e-5 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE8 subfamily. This PDE hydrolyzes the second messenger, cAMP, which is a regulator and mediator of a number of cellular responses to extracellular signals. Thus, by regulating the cellular concentration of cAMP, this protein plays a key role in many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2011]
PHENOTYPE: Targeted disruption of this gene results in a 4-fold increase in basal release of testosterone in isolated Leydig cells as well as a significant increase in the sensitivity to luteinizing hormone, measured as testosterone released into the media. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Atf7 A G 15: 102,534,327 V449A probably benign Het
Ccr1 G A 9: 123,964,400 A31V probably benign Het
Chrna6 A T 8: 27,406,683 S389T probably benign Het
Clic6 C T 16: 92,492,157 probably benign Het
Cmya5 G A 13: 93,091,918 R2221* probably null Het
Coq8b G T 7: 27,233,505 C13F probably benign Het
Cspg4 T A 9: 56,888,629 L1216Q possibly damaging Het
Decr1 C A 4: 15,930,979 V118F probably damaging Het
Dlec1 A T 9: 119,128,078 I796F probably damaging Het
Dnajc11 T A 4: 151,979,941 D516E probably damaging Het
Dock8 G A 19: 25,188,358 V1869M probably damaging Het
Dst A G 1: 34,188,738 D1982G probably damaging Het
Gm11808 C T 4: 3,973,244 R106H probably benign Het
Gnptab G A 10: 88,414,595 D190N probably benign Het
Golga4 A G 9: 118,556,845 K22E probably damaging Het
Hecw2 T C 1: 53,813,222 *1579W probably null Het
Ica1l A G 1: 60,013,818 probably null Het
Ift122 T A 6: 115,890,588 L433Q probably damaging Het
Iqgap1 T C 7: 80,762,567 probably null Het
Klra13-ps T C 6: 130,291,269 noncoding transcript Het
Mndal A T 1: 173,875,664 Y58* probably null Het
Mvb12b G C 2: 33,827,700 P172R possibly damaging Het
Ncapg T C 5: 45,671,212 F102L probably damaging Het
Olfr1447 T A 19: 12,901,268 K171* probably null Het
Olfr235 T C 19: 12,268,824 V198A possibly damaging Het
Olfr390 T C 11: 73,787,166 V76A probably damaging Het
Rbks T C 5: 31,624,568 N296S probably benign Het
Sema3c G A 5: 17,694,772 V421I probably benign Het
Tm9sf1 A G 14: 55,638,108 V393A possibly damaging Het
Tubgcp2 G A 7: 139,996,071 P893L possibly damaging Het
Vnn3 G A 10: 23,856,326 R158H probably benign Het
Zfa-ps G T 10: 52,544,936 noncoding transcript Het
Zfp414 T C 17: 33,631,648 probably benign Het
Zfp810 G A 9: 22,278,745 T289I probably damaging Het
Zfp819 G T 7: 43,617,785 R488L probably damaging Het
Zfp942 C T 17: 21,928,304 G448D probably benign Het
Zscan12 A G 13: 21,366,705 K165E possibly damaging Het
Other mutations in Pde8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Pde8a APN 7 81306708 missense possibly damaging 0.62
IGL00808:Pde8a APN 7 81283014 critical splice donor site probably null
IGL01134:Pde8a APN 7 81319078 missense possibly damaging 0.86
IGL01443:Pde8a APN 7 81324181 missense probably damaging 1.00
IGL02044:Pde8a APN 7 81317449 critical splice donor site probably null
IGL02269:Pde8a APN 7 81308802 splice site probably benign
IGL02528:Pde8a APN 7 81293189 splice site probably benign
IGL02738:Pde8a APN 7 81326342 missense probably damaging 1.00
IGL02937:Pde8a APN 7 81295771 splice site probably benign
IGL03072:Pde8a APN 7 81308809 missense probably damaging 1.00
cast_iron UTSW 7 81282807 splice site probably null
K7894:Pde8a UTSW 7 81306765 missense probably damaging 1.00
R0069:Pde8a UTSW 7 81319123 splice site probably benign
R0069:Pde8a UTSW 7 81319123 splice site probably benign
R0547:Pde8a UTSW 7 81324130 missense probably benign 0.00
R0552:Pde8a UTSW 7 81317347 missense probably benign 0.12
R1342:Pde8a UTSW 7 81302294 critical splice donor site probably null
R1469:Pde8a UTSW 7 81302271 missense probably damaging 1.00
R1469:Pde8a UTSW 7 81302271 missense probably damaging 1.00
R1502:Pde8a UTSW 7 81292259 missense probably damaging 1.00
R1568:Pde8a UTSW 7 81292263 missense probably damaging 1.00
R1768:Pde8a UTSW 7 81300723 splice site probably null
R2076:Pde8a UTSW 7 81308945 missense probably benign 0.11
R2165:Pde8a UTSW 7 81295768 critical splice donor site probably null
R2385:Pde8a UTSW 7 81282992 missense probably benign 0.45
R2518:Pde8a UTSW 7 81317422 missense probably benign 0.00
R4001:Pde8a UTSW 7 81317356 missense probably damaging 1.00
R4114:Pde8a UTSW 7 81282807 splice site probably null
R4115:Pde8a UTSW 7 81282807 splice site probably null
R4159:Pde8a UTSW 7 81320659 missense probably benign 0.13
R4299:Pde8a UTSW 7 81328035 missense probably benign
R4544:Pde8a UTSW 7 81328099 missense probably damaging 0.98
R4561:Pde8a UTSW 7 81308820 nonsense probably null
R4562:Pde8a UTSW 7 81308820 nonsense probably null
R4563:Pde8a UTSW 7 81308820 nonsense probably null
R4615:Pde8a UTSW 7 81320737 missense probably damaging 1.00
R4808:Pde8a UTSW 7 81282931 missense probably benign
R5396:Pde8a UTSW 7 81333422 missense probably damaging 1.00
R5840:Pde8a UTSW 7 81213965 missense probably benign
R5892:Pde8a UTSW 7 81295691 missense probably damaging 0.99
R6621:Pde8a UTSW 7 81293130 critical splice acceptor site probably null
R7067:Pde8a UTSW 7 81317326 missense probably benign 0.41
R7163:Pde8a UTSW 7 81306708 missense possibly damaging 0.62
R7483:Pde8a UTSW 7 81282833 missense probably benign 0.02
R7606:Pde8a UTSW 7 81332967 missense probably damaging 0.98
R7876:Pde8a UTSW 7 81324071 missense probably damaging 1.00
R8046:Pde8a UTSW 7 81308839 missense possibly damaging 0.90
R8046:Pde8a UTSW 7 81317370 missense probably benign 0.14
R8832:Pde8a UTSW 7 81306750 missense probably benign 0.16
R9133:Pde8a UTSW 7 81332871 missense probably damaging 1.00
R9134:Pde8a UTSW 7 81332871 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTCCTTTAGAGAGGAAGCC -3'
(R):5'- AGCTTTATGGTGTTCCCGAG -3'

Sequencing Primer
(F):5'- GCGCTCTGCTGAAGTCTTCAAC -3'
(R):5'- ATGGTGTTCCCGAGTCCAC -3'
Posted On2015-08-18