Incidental Mutation 'R4545:Tubgcp2'
ID333720
Institutional Source Beutler Lab
Gene Symbol Tubgcp2
Ensembl Gene ENSMUSG00000025474
Gene Nametubulin, gamma complex associated protein 2
Synonyms1700022B05Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R4545 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location139995955-140036669 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 139996071 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 893 (P893L)
Ref Sequence ENSEMBL: ENSMUSP00000026547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026546] [ENSMUST00000026547] [ENSMUST00000106069] [ENSMUST00000148670] [ENSMUST00000173209] [ENSMUST00000210224] [ENSMUST00000211638]
Predicted Effect probably benign
Transcript: ENSMUST00000026546
SMART Domains Protein: ENSMUSP00000026546
Gene: ENSMUSG00000025473

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 151 5.9e-35 PFAM
Pfam:Reprolysin_5 193 371 1e-22 PFAM
Pfam:Reprolysin_4 193 384 1.7e-16 PFAM
Pfam:Reprolysin 195 394 2.7e-70 PFAM
Pfam:Reprolysin_2 214 384 1.6e-16 PFAM
Pfam:Reprolysin_3 218 339 4.9e-21 PFAM
DISIN 411 486 5.16e-36 SMART
ACR 487 606 2.15e-35 SMART
EGF 613 642 3.06e-1 SMART
transmembrane domain 660 682 N/A INTRINSIC
low complexity region 732 762 N/A INTRINSIC
low complexity region 770 783 N/A INTRINSIC
low complexity region 784 812 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000026547
AA Change: P893L

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000026547
Gene: ENSMUSG00000025474
AA Change: P893L

DomainStartEndE-ValueType
low complexity region 109 121 N/A INTRINSIC
Pfam:Spc97_Spc98 220 738 8.6e-123 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106069
SMART Domains Protein: ENSMUSP00000101684
Gene: ENSMUSG00000025473

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 28 152 4e-30 PFAM
Pfam:Reprolysin_5 194 372 9.6e-23 PFAM
Pfam:Reprolysin_4 194 385 1.6e-16 PFAM
Pfam:Reprolysin 196 395 2.2e-73 PFAM
Pfam:Reprolysin_2 215 385 2.9e-18 PFAM
Pfam:Reprolysin_3 219 340 6.6e-21 PFAM
DISIN 412 487 5.16e-36 SMART
ACR 488 607 2.15e-35 SMART
EGF 614 643 3.06e-1 SMART
transmembrane domain 661 683 N/A INTRINSIC
low complexity region 733 763 N/A INTRINSIC
low complexity region 771 784 N/A INTRINSIC
low complexity region 785 813 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128332
Predicted Effect probably benign
Transcript: ENSMUST00000148670
SMART Domains Protein: ENSMUSP00000117858
Gene: ENSMUSG00000025473

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 151 1.8e-35 PFAM
Pfam:Reprolysin_5 193 371 3.6e-23 PFAM
Pfam:Reprolysin_4 193 384 6e-17 PFAM
Pfam:Reprolysin 195 394 8.2e-71 PFAM
Pfam:Reprolysin_2 214 384 5.8e-17 PFAM
Pfam:Reprolysin_3 218 339 1.7e-21 PFAM
DISIN 411 486 5.16e-36 SMART
ACR 487 612 2.21e-32 SMART
EGF 619 648 3.06e-1 SMART
transmembrane domain 666 688 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173209
SMART Domains Protein: ENSMUSP00000133673
Gene: ENSMUSG00000025473

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 31 45 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209930
Predicted Effect probably benign
Transcript: ENSMUST00000210224
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211186
Predicted Effect probably benign
Transcript: ENSMUST00000211638
AA Change: P893L

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.0819 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Atf7 A G 15: 102,534,327 V449A probably benign Het
Ccr1 G A 9: 123,964,400 A31V probably benign Het
Chrna6 A T 8: 27,406,683 S389T probably benign Het
Clic6 C T 16: 92,492,157 probably benign Het
Cmya5 G A 13: 93,091,918 R2221* probably null Het
Coq8b G T 7: 27,233,505 C13F probably benign Het
Cspg4 T A 9: 56,888,629 L1216Q possibly damaging Het
Decr1 C A 4: 15,930,979 V118F probably damaging Het
Dlec1 A T 9: 119,128,078 I796F probably damaging Het
Dnajc11 T A 4: 151,979,941 D516E probably damaging Het
Dock8 G A 19: 25,188,358 V1869M probably damaging Het
Dst A G 1: 34,188,738 D1982G probably damaging Het
Gm11808 C T 4: 3,973,244 R106H probably benign Het
Gnptab G A 10: 88,414,595 D190N probably benign Het
Golga4 A G 9: 118,556,845 K22E probably damaging Het
Hecw2 T C 1: 53,813,222 *1579W probably null Het
Ica1l A G 1: 60,013,818 probably null Het
Ift122 T A 6: 115,890,588 L433Q probably damaging Het
Iqgap1 T C 7: 80,762,567 probably null Het
Klra13-ps T C 6: 130,291,269 noncoding transcript Het
Mndal A T 1: 173,875,664 Y58* probably null Het
Mvb12b G C 2: 33,827,700 P172R possibly damaging Het
Ncapg T C 5: 45,671,212 F102L probably damaging Het
Olfr1447 T A 19: 12,901,268 K171* probably null Het
Olfr235 T C 19: 12,268,824 V198A possibly damaging Het
Olfr390 T C 11: 73,787,166 V76A probably damaging Het
Pde8a A T 7: 81,328,099 R713S probably damaging Het
Rbks T C 5: 31,624,568 N296S probably benign Het
Sema3c G A 5: 17,694,772 V421I probably benign Het
Tm9sf1 A G 14: 55,638,108 V393A possibly damaging Het
Vnn3 G A 10: 23,856,326 R158H probably benign Het
Zfa-ps G T 10: 52,544,936 noncoding transcript Het
Zfp414 T C 17: 33,631,648 probably benign Het
Zfp810 G A 9: 22,278,745 T289I probably damaging Het
Zfp819 G T 7: 43,617,785 R488L probably damaging Het
Zfp942 C T 17: 21,928,304 G448D probably benign Het
Zscan12 A G 13: 21,366,705 K165E possibly damaging Het
Other mutations in Tubgcp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Tubgcp2 APN 7 140031022 missense possibly damaging 0.58
IGL00791:Tubgcp2 APN 7 140001498 missense probably damaging 0.97
IGL02643:Tubgcp2 APN 7 139996154 missense probably damaging 1.00
IGL02710:Tubgcp2 APN 7 140004984 splice site probably benign
IGL03352:Tubgcp2 APN 7 140001027 missense probably benign 0.01
R0189:Tubgcp2 UTSW 7 140001605 splice site probably benign
R0333:Tubgcp2 UTSW 7 139999347 missense probably damaging 1.00
R0379:Tubgcp2 UTSW 7 140032192 missense probably damaging 1.00
R1051:Tubgcp2 UTSW 7 139998896 missense probably benign 0.26
R1192:Tubgcp2 UTSW 7 140029838 missense probably benign
R1528:Tubgcp2 UTSW 7 140033783 unclassified probably benign
R1728:Tubgcp2 UTSW 7 139998055 missense probably benign
R1729:Tubgcp2 UTSW 7 139998055 missense probably benign
R1784:Tubgcp2 UTSW 7 139998055 missense probably benign
R1888:Tubgcp2 UTSW 7 139999270 missense probably damaging 1.00
R1888:Tubgcp2 UTSW 7 140006156 missense probably damaging 1.00
R1888:Tubgcp2 UTSW 7 139999270 missense probably damaging 1.00
R1888:Tubgcp2 UTSW 7 140006156 missense probably damaging 1.00
R1967:Tubgcp2 UTSW 7 140006153 missense probably benign 0.09
R4514:Tubgcp2 UTSW 7 139996071 missense possibly damaging 0.51
R4774:Tubgcp2 UTSW 7 139996161 missense probably damaging 1.00
R4790:Tubgcp2 UTSW 7 139999288 missense probably damaging 1.00
R5114:Tubgcp2 UTSW 7 140007441 missense possibly damaging 0.91
R5435:Tubgcp2 UTSW 7 139996072 missense possibly damaging 0.51
R5531:Tubgcp2 UTSW 7 140005024 splice site probably null
R5699:Tubgcp2 UTSW 7 139998788 missense possibly damaging 0.53
R5706:Tubgcp2 UTSW 7 140032225 nonsense probably null
R6123:Tubgcp2 UTSW 7 140007597 missense probably damaging 1.00
R7153:Tubgcp2 UTSW 7 140001036 missense probably benign
R7165:Tubgcp2 UTSW 7 140005361 missense probably damaging 0.99
R7213:Tubgcp2 UTSW 7 140008014 missense probably benign 0.28
R7424:Tubgcp2 UTSW 7 140007924 missense possibly damaging 0.65
R7511:Tubgcp2 UTSW 7 140004880 missense probably benign 0.00
R7523:Tubgcp2 UTSW 7 140006870 missense probably benign 0.08
R7612:Tubgcp2 UTSW 7 140001051 missense probably damaging 1.00
R7951:Tubgcp2 UTSW 7 140007980 missense possibly damaging 0.69
R8220:Tubgcp2 UTSW 7 140006140 missense possibly damaging 0.92
X0004:Tubgcp2 UTSW 7 140007021 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TCTGAAAAGCTTCTAAAAGGAAGTC -3'
(R):5'- TGAACCTGTCACATGATTGGGAG -3'

Sequencing Primer
(F):5'- AAGCTTCTAAAAGGAAGTCTAACATC -3'
(R):5'- ATAACCATGGCAGATCCTGTG -3'
Posted On2015-08-18