Incidental Mutation 'R4545:Chrna6'
ID333721
Institutional Source Beutler Lab
Gene Symbol Chrna6
Ensembl Gene ENSMUSG00000031491
Gene Namecholinergic receptor, nicotinic, alpha polypeptide 6
SynonymsAcra6, alpha6 nAChR
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R4545 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location27403212-27413944 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 27406683 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 389 (S389T)
Ref Sequence ENSEMBL: ENSMUSP00000033882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033882]
Predicted Effect probably benign
Transcript: ENSMUST00000033882
AA Change: S389T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033882
Gene: ENSMUSG00000031491
AA Change: S389T

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 34 240 1.7e-78 PFAM
Pfam:Neur_chan_memb 247 483 1.2e-89 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha subunit of neuronal nicotinic acetylcholine receptors. These receptors consist of five subunits and function as ion channels involved in neurotransmission. The encoded protein is a subunit of neuronal nicotinic acetylcholine receptors that mediate dopaminergic neurotransmission and are activated by acetylcholine and exogenous nicotine. Alternatively spliced transcript variants have been observed for this gene. Single nucleotide polymorphisms in this gene have been associated with both nicotine and alcohol dependence. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homzygous mutant animals have decreased numbers of high affinity binding sites for [3H]nicotine, [3H]epibaditine, and [3H]cytisine in the terminal region of the retinal ganglion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Atf7 A G 15: 102,534,327 V449A probably benign Het
Ccr1 G A 9: 123,964,400 A31V probably benign Het
Clic6 C T 16: 92,492,157 probably benign Het
Cmya5 G A 13: 93,091,918 R2221* probably null Het
Coq8b G T 7: 27,233,505 C13F probably benign Het
Cspg4 T A 9: 56,888,629 L1216Q possibly damaging Het
Decr1 C A 4: 15,930,979 V118F probably damaging Het
Dlec1 A T 9: 119,128,078 I796F probably damaging Het
Dnajc11 T A 4: 151,979,941 D516E probably damaging Het
Dock8 G A 19: 25,188,358 V1869M probably damaging Het
Dst A G 1: 34,188,738 D1982G probably damaging Het
Gm11808 C T 4: 3,973,244 R106H probably benign Het
Gnptab G A 10: 88,414,595 D190N probably benign Het
Golga4 A G 9: 118,556,845 K22E probably damaging Het
Hecw2 T C 1: 53,813,222 *1579W probably null Het
Ica1l A G 1: 60,013,818 probably null Het
Ift122 T A 6: 115,890,588 L433Q probably damaging Het
Iqgap1 T C 7: 80,762,567 probably null Het
Klra13-ps T C 6: 130,291,269 noncoding transcript Het
Mndal A T 1: 173,875,664 Y58* probably null Het
Mvb12b G C 2: 33,827,700 P172R possibly damaging Het
Ncapg T C 5: 45,671,212 F102L probably damaging Het
Olfr1447 T A 19: 12,901,268 K171* probably null Het
Olfr235 T C 19: 12,268,824 V198A possibly damaging Het
Olfr390 T C 11: 73,787,166 V76A probably damaging Het
Pde8a A T 7: 81,328,099 R713S probably damaging Het
Rbks T C 5: 31,624,568 N296S probably benign Het
Sema3c G A 5: 17,694,772 V421I probably benign Het
Tm9sf1 A G 14: 55,638,108 V393A possibly damaging Het
Tubgcp2 G A 7: 139,996,071 P893L possibly damaging Het
Vnn3 G A 10: 23,856,326 R158H probably benign Het
Zfa-ps G T 10: 52,544,936 noncoding transcript Het
Zfp414 T C 17: 33,631,648 probably benign Het
Zfp810 G A 9: 22,278,745 T289I probably damaging Het
Zfp819 G T 7: 43,617,785 R488L probably damaging Het
Zfp942 C T 17: 21,928,304 G448D probably benign Het
Zscan12 A G 13: 21,366,705 K165E possibly damaging Het
Other mutations in Chrna6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Chrna6 APN 8 27406532 missense probably damaging 1.00
IGL02040:Chrna6 APN 8 27407261 missense probably damaging 0.99
IGL02067:Chrna6 APN 8 27404396 missense probably damaging 1.00
IGL02674:Chrna6 APN 8 27406851 missense probably benign 0.00
IGL03011:Chrna6 APN 8 27413654 missense possibly damaging 0.48
R0087:Chrna6 UTSW 8 27406986 missense probably damaging 1.00
R0421:Chrna6 UTSW 8 27408387 missense probably null 0.98
R0786:Chrna6 UTSW 8 27408380 missense probably benign 0.26
R1784:Chrna6 UTSW 8 27406784 missense possibly damaging 0.60
R1834:Chrna6 UTSW 8 27407214 missense probably benign 0.04
R2087:Chrna6 UTSW 8 27407127 missense probably benign 0.00
R4785:Chrna6 UTSW 8 27407106 missense probably damaging 1.00
R5621:Chrna6 UTSW 8 27407040 missense probably damaging 1.00
R6002:Chrna6 UTSW 8 27406746 missense probably benign 0.03
R6834:Chrna6 UTSW 8 27408310 splice site probably null
R6937:Chrna6 UTSW 8 27407027 missense probably damaging 1.00
R6968:Chrna6 UTSW 8 27406655 missense probably benign 0.01
R7303:Chrna6 UTSW 8 27406991 nonsense probably null
R7319:Chrna6 UTSW 8 27406787 missense possibly damaging 0.58
R7775:Chrna6 UTSW 8 27407364 missense probably damaging 1.00
R7778:Chrna6 UTSW 8 27407364 missense probably damaging 1.00
R7824:Chrna6 UTSW 8 27407364 missense probably damaging 1.00
R7879:Chrna6 UTSW 8 27407081 missense probably damaging 1.00
R8100:Chrna6 UTSW 8 27413816 start gained probably benign
R8292:Chrna6 UTSW 8 27406726 missense probably benign 0.05
Z1177:Chrna6 UTSW 8 27413689 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGGCTCCACTTTTACCTCG -3'
(R):5'- GTGCTGAACATACACTACAGGACC -3'

Sequencing Primer
(F):5'- ACCTCGTTTGTTTCATTGTGGC -3'
(R):5'- TACAGGACCCCAGCAACG -3'
Posted On2015-08-18