Mutagenetix > Incidental Mutation

Incidental Mutation 'R4545:Cspg4'

333723

Institutional Source

Beutler Lab

Gene Symbol

Cspg4

Ensembl Gene

ENSMUSG00000032911

Gene Name

chondroitin sulfate proteoglycan 4

Synonyms

AN2, 4732461B14Rik, NG2

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4545 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

56865033-56899870 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 56888629 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 1216 (L1216Q)

Ref Sequence

ENSEMBL: ENSMUSP00000038909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035661]

AlphaFold

Q8VHY0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000035661
AA Change: L1216Q

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000038909
Gene: ENSMUSG00000032911
AA Change: L1216Q

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
LamG	47	179	9.16e-22	SMART
LamG	223	364	3.52e-23	SMART
low complexity region	384	397	N/A	INTRINSIC
Pfam:Cadherin_3	495	646	1e-36	PFAM
Pfam:Cadherin_3	732	885	7.9e-14	PFAM
Pfam:Cadherin_3	868	996	7e-15	PFAM
Pfam:Cadherin_3	972	1115	9e-26	PFAM
Pfam:Cadherin_3	1116	1223	1.1e-10	PFAM
Pfam:Cadherin_3	1225	1344	3.3e-12	PFAM
Pfam:Cadherin_3	1425	1568	6.3e-52	PFAM
Pfam:Cadherin_3	1578	1684	9.7e-9	PFAM
Pfam:Cadherin_3	1674	1809	3.2e-9	PFAM
Pfam:Cadherin_3	1779	1929	1.6e-31	PFAM
transmembrane domain	2229	2251	N/A	INTRINSIC
low complexity region	2295	2305	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214057

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215666

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

98% (41/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A human melanoma-associated chondroitin sulfate proteoglycan plays a role in stabilizing cell-substratum interactions during early events of melanoma cell spreading on endothelial basement membranes. CSPG4 represents an integral membrane chondroitin sulfate proteoglycan expressed by human malignant melanoma cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display abnormal dentate gyrus morphology and abnormal smooth muscle cell physiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akr1c20	A	C	13: 4,507,844	V201G	probably damaging	Het
Atf7	A	G	15: 102,534,327	V449A	probably benign	Het
Ccr1	G	A	9: 123,964,400	A31V	probably benign	Het
Chrna6	A	T	8: 27,406,683	S389T	probably benign	Het
Clic6	C	T	16: 92,492,157		probably benign	Het
Cmya5	G	A	13: 93,091,918	R2221*	probably null	Het
Coq8b	G	T	7: 27,233,505	C13F	probably benign	Het
Decr1	C	A	4: 15,930,979	V118F	probably damaging	Het
Dlec1	A	T	9: 119,128,078	I796F	probably damaging	Het
Dnajc11	T	A	4: 151,979,941	D516E	probably damaging	Het
Dock8	G	A	19: 25,188,358	V1869M	probably damaging	Het
Dst	A	G	1: 34,188,738	D1982G	probably damaging	Het
Gm11808	C	T	4: 3,973,244	R106H	probably benign	Het
Gnptab	G	A	10: 88,414,595	D190N	probably benign	Het
Golga4	A	G	9: 118,556,845	K22E	probably damaging	Het
Hecw2	T	C	1: 53,813,222	*1579W	probably null	Het
Ica1l	A	G	1: 60,013,818		probably null	Het
Ift122	T	A	6: 115,890,588	L433Q	probably damaging	Het
Iqgap1	T	C	7: 80,762,567		probably null	Het
Klra13-ps	T	C	6: 130,291,269		noncoding transcript	Het
Mndal	A	T	1: 173,875,664	Y58*	probably null	Het
Mvb12b	G	C	2: 33,827,700	P172R	possibly damaging	Het
Ncapg	T	C	5: 45,671,212	F102L	probably damaging	Het
Olfr1447	T	A	19: 12,901,268	K171*	probably null	Het
Olfr235	T	C	19: 12,268,824	V198A	possibly damaging	Het
Olfr390	T	C	11: 73,787,166	V76A	probably damaging	Het
Pde8a	A	T	7: 81,328,099	R713S	probably damaging	Het
Rbks	T	C	5: 31,624,568	N296S	probably benign	Het
Sema3c	G	A	5: 17,694,772	V421I	probably benign	Het
Tm9sf1	A	G	14: 55,638,108	V393A	possibly damaging	Het
Tubgcp2	G	A	7: 139,996,071	P893L	possibly damaging	Het
Vnn3	G	A	10: 23,856,326	R158H	probably benign	Het
Zfa-ps	G	T	10: 52,544,936		noncoding transcript	Het
Zfp414	T	C	17: 33,631,648		probably benign	Het
Zfp810	G	A	9: 22,278,745	T289I	probably damaging	Het
Zfp819	G	T	7: 43,617,785	R488L	probably damaging	Het
Zfp942	C	T	17: 21,928,304	G448D	probably benign	Het
Zscan12	A	G	13: 21,366,705	K165E	possibly damaging	Het

Other mutations in Cspg4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01074:Cspg4	APN	9	56898865	missense	probably damaging	1.00
IGL01322:Cspg4	APN	9	56898588	missense	probably damaging	1.00
IGL01922:Cspg4	APN	9	56887887	missense	probably damaging	1.00
IGL01993:Cspg4	APN	9	56898478	missense	probably benign	0.09
IGL02379:Cspg4	APN	9	56892609	splice site	probably benign
IGL02398:Cspg4	APN	9	56886686	missense	probably benign	0.43
IGL02503:Cspg4	APN	9	56897403	missense	probably damaging	1.00
IGL02504:Cspg4	APN	9	56885772	missense	probably benign	0.06
IGL02692:Cspg4	APN	9	56887454	missense	probably benign	0.00
IGL02728:Cspg4	APN	9	56886481	missense	probably damaging	1.00
IGL02806:Cspg4	APN	9	56890259	missense	possibly damaging	0.57
IGL02886:Cspg4	APN	9	56897388	missense	probably damaging	0.99
IGL03005:Cspg4	APN	9	56888488	missense	probably damaging	1.00
IGL03008:Cspg4	APN	9	56898475	missense	possibly damaging	0.48
IGL03202:Cspg4	APN	9	56897739	missense	possibly damaging	0.93
chiclets	UTSW	9	56885222	splice site	probably null
R0066:Cspg4	UTSW	9	56888134	missense	probably damaging	1.00
R0066:Cspg4	UTSW	9	56888134	missense	probably damaging	1.00
R0254:Cspg4	UTSW	9	56897410	missense	probably damaging	0.98
R0284:Cspg4	UTSW	9	56886139	missense	probably damaging	0.96
R0513:Cspg4	UTSW	9	56898091	missense	probably benign	0.03
R0602:Cspg4	UTSW	9	56888017	missense	probably damaging	1.00
R0747:Cspg4	UTSW	9	56890280	missense	probably damaging	1.00
R1005:Cspg4	UTSW	9	56888736	missense	probably benign	0.13
R1421:Cspg4	UTSW	9	56896626	missense	probably benign	0.00
R1443:Cspg4	UTSW	9	56886512	missense	probably damaging	1.00
R1481:Cspg4	UTSW	9	56887810	missense	probably damaging	0.98
R1585:Cspg4	UTSW	9	56898867	missense	probably damaging	0.99
R1624:Cspg4	UTSW	9	56888470	missense	probably damaging	1.00
R1670:Cspg4	UTSW	9	56897403	missense	probably damaging	1.00
R1721:Cspg4	UTSW	9	56888743	missense	probably damaging	0.98
R1728:Cspg4	UTSW	9	56898537	missense	probably benign	0.00
R1729:Cspg4	UTSW	9	56898537	missense	probably benign	0.00
R1763:Cspg4	UTSW	9	56886979	missense	probably damaging	0.97
R1772:Cspg4	UTSW	9	56897492	missense	probably benign	0.02
R1938:Cspg4	UTSW	9	56887101	missense	probably benign	0.00
R1975:Cspg4	UTSW	9	56890478	missense	probably damaging	1.00
R2064:Cspg4	UTSW	9	56896656	missense	probably damaging	1.00
R2185:Cspg4	UTSW	9	56886972	missense	probably benign	0.37
R2252:Cspg4	UTSW	9	56898046	missense	probably damaging	1.00
R2291:Cspg4	UTSW	9	56892743	missense	probably damaging	0.96
R2329:Cspg4	UTSW	9	56888550	missense	probably benign	0.00
R3780:Cspg4	UTSW	9	56888233	missense	probably damaging	1.00
R3830:Cspg4	UTSW	9	56897621	missense	probably damaging	0.99
R3944:Cspg4	UTSW	9	56886123	missense	probably damaging	1.00
R4011:Cspg4	UTSW	9	56887317	missense	probably benign	0.19
R4115:Cspg4	UTSW	9	56898394	missense	probably damaging	1.00
R4173:Cspg4	UTSW	9	56887930	missense	probably damaging	1.00
R4243:Cspg4	UTSW	9	56887857	missense	probably benign	0.12
R4329:Cspg4	UTSW	9	56892465	missense	probably damaging	0.99
R4544:Cspg4	UTSW	9	56888629	missense	possibly damaging	0.79
R4546:Cspg4	UTSW	9	56888629	missense	possibly damaging	0.79
R4649:Cspg4	UTSW	9	56886865	missense	possibly damaging	0.93
R4663:Cspg4	UTSW	9	56886676	missense	possibly damaging	0.61
R4674:Cspg4	UTSW	9	56898205	missense	probably damaging	1.00
R4779:Cspg4	UTSW	9	56885808	missense	probably damaging	1.00
R4884:Cspg4	UTSW	9	56898069	missense	probably benign	0.00
R5021:Cspg4	UTSW	9	56897730	missense	probably benign	0.01
R5051:Cspg4	UTSW	9	56885736	missense	possibly damaging	0.95
R5328:Cspg4	UTSW	9	56885856	missense	probably benign	0.01
R5394:Cspg4	UTSW	9	56890200	missense	probably damaging	1.00
R5567:Cspg4	UTSW	9	56886648	missense	probably benign	0.00
R5682:Cspg4	UTSW	9	56886196	missense	probably benign	0.14
R5690:Cspg4	UTSW	9	56898735	missense	probably benign	0.01
R5715:Cspg4	UTSW	9	56891051	missense	possibly damaging	0.90
R5717:Cspg4	UTSW	9	56885798	missense	probably benign
R5726:Cspg4	UTSW	9	56885904	missense	probably damaging	1.00
R5898:Cspg4	UTSW	9	56885222	splice site	probably null
R6140:Cspg4	UTSW	9	56897224	missense	probably benign	0.35
R6147:Cspg4	UTSW	9	56888772	missense	probably damaging	0.99
R6239:Cspg4	UTSW	9	56888182	missense	probably benign	0.04
R6343:Cspg4	UTSW	9	56892692	missense	probably benign
R6351:Cspg4	UTSW	9	56892644	missense	probably benign	0.00
R6564:Cspg4	UTSW	9	56890158	missense	probably benign	0.02
R6814:Cspg4	UTSW	9	56890340	missense	possibly damaging	0.91
R6928:Cspg4	UTSW	9	56897880	missense	possibly damaging	0.95
R6967:Cspg4	UTSW	9	56890136	missense	possibly damaging	0.52
R6981:Cspg4	UTSW	9	56887101	missense	probably benign	0.00
R7033:Cspg4	UTSW	9	56888074	missense	probably damaging	0.96
R7419:Cspg4	UTSW	9	56888443	missense	possibly damaging	0.94
R7809:Cspg4	UTSW	9	56890190	missense	probably damaging	1.00
R7940:Cspg4	UTSW	9	56888097	nonsense	probably null
R8078:Cspg4	UTSW	9	56890259	missense	possibly damaging	0.57
R8082:Cspg4	UTSW	9	56885893	missense	probably damaging	1.00
R8217:Cspg4	UTSW	9	56890353	missense	possibly damaging	0.53
R8237:Cspg4	UTSW	9	56892680	missense	probably damaging	1.00
R8353:Cspg4	UTSW	9	56898669	missense	probably damaging	1.00
R8372:Cspg4	UTSW	9	56887195	missense	probably damaging	1.00
R8691:Cspg4	UTSW	9	56892996	missense	probably benign
R8720:Cspg4	UTSW	9	56887513	missense	probably benign	0.25
R8907:Cspg4	UTSW	9	56883683	missense	probably damaging	1.00
R9063:Cspg4	UTSW	9	56888403	missense	probably benign	0.03
R9115:Cspg4	UTSW	9	56890452	missense	probably damaging	1.00
R9152:Cspg4	UTSW	9	56888179	missense	probably benign	0.26
R9154:Cspg4	UTSW	9	56891003	missense
R9361:Cspg4	UTSW	9	56896593	missense	probably damaging	1.00
R9574:Cspg4	UTSW	9	56890058	missense	probably damaging	1.00
R9608:Cspg4	UTSW	9	56885552	missense	probably benign
R9685:Cspg4	UTSW	9	56890338	missense	probably benign	0.05
X0065:Cspg4	UTSW	9	56885736	missense	possibly damaging	0.95
Z1088:Cspg4	UTSW	9	56886036	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTAGTCTCGTGGTTCCTCAAG -3'
(R):5'- ACTGCCTTACCTCTAGCTGG -3'

Sequencing Primer
(F):5'- GGCACCATTGACACTGCTG -3'
(R):5'- AGCTGGTCCCTTCTGATCTCAG -3'

Posted On

2015-08-18