Mutagenetix > Incidental Mutation

Incidental Mutation 'R4545:Dlec1'

333726

Institutional Source

Beutler Lab

Gene Symbol

Dlec1

Ensembl Gene

ENSMUSG00000038060

Gene Name

deleted in lung and esophageal cancer 1

Synonyms

D630005C06Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4545 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

119102478-119148246 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 119128078 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 796 (I796F)

Ref Sequence

ENSEMBL: ENSMUSP00000128874 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055775] [ENSMUST00000140326] [ENSMUST00000165231]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000055775

SMART Domains

Protein: ENSMUSP00000052645
Gene: ENSMUSG00000038060

Domain	Start	End	E-Value	Type
coiled coil region	127	154	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124213

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128211

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137047

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138736

Predicted Effect

probably damaging
Transcript: ENSMUST00000140326
AA Change: I796F

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000122380
Gene: ENSMUSG00000038060
AA Change: I796F

Domain	Start	End	E-Value	Type
coiled coil region	127	154	N/A	INTRINSIC
low complexity region	1025	1042	N/A	INTRINSIC
low complexity region	1343	1354	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148611

Predicted Effect

probably damaging
Transcript: ENSMUST00000165231
AA Change: I796F

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000128874
Gene: ENSMUSG00000038060
AA Change: I796F

Domain	Start	End	E-Value	Type
coiled coil region	127	154	N/A	INTRINSIC
low complexity region	1025	1042	N/A	INTRINSIC
low complexity region	1333	1354	N/A	INTRINSIC

Meta Mutation Damage Score

0.2022

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

98% (41/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cytogenetic location of this gene is 3p21.3, and it is located in a region that is commonly deleted in a variety of malignancies. Down-regulation of this gene has been observed in several human cancers including lung, esophageal, renal tumors, and head and neck squamous cell carcinoma. In some cases, reduced expression of this gene in tumor cells is a result of aberrant promoter methylation. Several alternatively spliced transcripts have been observed that contain disrupted coding regions and likely encode nonfunctional proteins.[provided by RefSeq, Mar 2016]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akr1c20	A	C	13: 4,507,844	V201G	probably damaging	Het
Atf7	A	G	15: 102,534,327	V449A	probably benign	Het
Ccr1	G	A	9: 123,964,400	A31V	probably benign	Het
Chrna6	A	T	8: 27,406,683	S389T	probably benign	Het
Clic6	C	T	16: 92,492,157		probably benign	Het
Cmya5	G	A	13: 93,091,918	R2221*	probably null	Het
Coq8b	G	T	7: 27,233,505	C13F	probably benign	Het
Cspg4	T	A	9: 56,888,629	L1216Q	possibly damaging	Het
Decr1	C	A	4: 15,930,979	V118F	probably damaging	Het
Dnajc11	T	A	4: 151,979,941	D516E	probably damaging	Het
Dock8	G	A	19: 25,188,358	V1869M	probably damaging	Het
Dst	A	G	1: 34,188,738	D1982G	probably damaging	Het
Gm11808	C	T	4: 3,973,244	R106H	probably benign	Het
Gnptab	G	A	10: 88,414,595	D190N	probably benign	Het
Golga4	A	G	9: 118,556,845	K22E	probably damaging	Het
Hecw2	T	C	1: 53,813,222	*1579W	probably null	Het
Ica1l	A	G	1: 60,013,818		probably null	Het
Ift122	T	A	6: 115,890,588	L433Q	probably damaging	Het
Iqgap1	T	C	7: 80,762,567		probably null	Het
Klra13-ps	T	C	6: 130,291,269		noncoding transcript	Het
Mndal	A	T	1: 173,875,664	Y58*	probably null	Het
Mvb12b	G	C	2: 33,827,700	P172R	possibly damaging	Het
Ncapg	T	C	5: 45,671,212	F102L	probably damaging	Het
Olfr1447	T	A	19: 12,901,268	K171*	probably null	Het
Olfr235	T	C	19: 12,268,824	V198A	possibly damaging	Het
Olfr390	T	C	11: 73,787,166	V76A	probably damaging	Het
Pde8a	A	T	7: 81,328,099	R713S	probably damaging	Het
Rbks	T	C	5: 31,624,568	N296S	probably benign	Het
Sema3c	G	A	5: 17,694,772	V421I	probably benign	Het
Tm9sf1	A	G	14: 55,638,108	V393A	possibly damaging	Het
Tubgcp2	G	A	7: 139,996,071	P893L	possibly damaging	Het
Vnn3	G	A	10: 23,856,326	R158H	probably benign	Het
Zfa-ps	G	T	10: 52,544,936		noncoding transcript	Het
Zfp414	T	C	17: 33,631,648		probably benign	Het
Zfp810	G	A	9: 22,278,745	T289I	probably damaging	Het
Zfp819	G	T	7: 43,617,785	R488L	probably damaging	Het
Zfp942	C	T	17: 21,928,304	G448D	probably benign	Het
Zscan12	A	G	13: 21,366,705	K165E	possibly damaging	Het

Other mutations in Dlec1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01106:Dlec1	APN	9	119102785	missense	probably benign	0.11
IGL01137:Dlec1	APN	9	119137311	missense	probably damaging	1.00
IGL01338:Dlec1	APN	9	119120911	missense	probably damaging	1.00
IGL01652:Dlec1	APN	9	119143907	missense	probably benign	0.01
IGL01923:Dlec1	APN	9	119128114	splice site	probably null
IGL02186:Dlec1	APN	9	119143627	missense	probably benign	0.00
IGL02597:Dlec1	APN	9	119134536	missense	probably damaging	0.99
IGL02667:Dlec1	APN	9	119127466	missense	probably benign	0.23
IGL02718:Dlec1	APN	9	119137286	missense	probably benign	0.01
IGL02731:Dlec1	APN	9	119147120	missense	probably benign	0.00
IGL02831:Dlec1	APN	9	119143915	missense	probably damaging	1.00
IGL03390:Dlec1	APN	9	119123220	missense	probably benign	0.00
I2288:Dlec1	UTSW	9	119143601	missense	probably damaging	1.00
R0109:Dlec1	UTSW	9	119105824	missense	probably damaging	1.00
R0144:Dlec1	UTSW	9	119142866	missense	probably benign
R0554:Dlec1	UTSW	9	119115002	missense	probably benign	0.44
R0611:Dlec1	UTSW	9	119112099	missense	probably benign	0.01
R1344:Dlec1	UTSW	9	119130017	missense	probably benign	0.09
R1467:Dlec1	UTSW	9	119142578	missense	probably damaging	1.00
R1467:Dlec1	UTSW	9	119128003	splice site	probably benign
R1467:Dlec1	UTSW	9	119142578	missense	probably damaging	1.00
R1539:Dlec1	UTSW	9	119127450	missense	probably benign	0.00
R1768:Dlec1	UTSW	9	119146007	splice site	probably null
R1809:Dlec1	UTSW	9	119136699	missense	probably benign	0.00
R1830:Dlec1	UTSW	9	119138790	missense	probably benign	0.00
R1901:Dlec1	UTSW	9	119102644	missense	probably damaging	0.99
R2060:Dlec1	UTSW	9	119112086	missense	probably damaging	1.00
R2092:Dlec1	UTSW	9	119121844	missense	possibly damaging	0.87
R2237:Dlec1	UTSW	9	119138191	critical splice donor site	probably null
R2983:Dlec1	UTSW	9	119146173	missense	probably benign	0.00
R3117:Dlec1	UTSW	9	119143903	splice site	probably null
R3816:Dlec1	UTSW	9	119124843	missense	probably damaging	1.00
R3826:Dlec1	UTSW	9	119143061	splice site	probably benign
R3965:Dlec1	UTSW	9	119128581	missense	probably benign	0.01
R4023:Dlec1	UTSW	9	119137340	missense	probably damaging	0.98
R4024:Dlec1	UTSW	9	119137340	missense	probably damaging	0.98
R4026:Dlec1	UTSW	9	119137340	missense	probably damaging	0.98
R4272:Dlec1	UTSW	9	119143163	missense	probably damaging	0.98
R4546:Dlec1	UTSW	9	119128078	missense	probably damaging	0.99
R4601:Dlec1	UTSW	9	119147134	critical splice donor site	probably null
R4695:Dlec1	UTSW	9	119143153	missense	probably benign	0.00
R4996:Dlec1	UTSW	9	119146050	missense	probably damaging	1.00
R5321:Dlec1	UTSW	9	119112601	missense	probably benign	0.02
R5521:Dlec1	UTSW	9	119143401	missense	possibly damaging	0.92
R5650:Dlec1	UTSW	9	119143594	nonsense	probably null
R5825:Dlec1	UTSW	9	119142968	missense	probably damaging	1.00
R5941:Dlec1	UTSW	9	119126312	missense	probably damaging	0.98
R6056:Dlec1	UTSW	9	119121923	missense	probably damaging	0.98
R6111:Dlec1	UTSW	9	119102624	missense	possibly damaging	0.59
R6156:Dlec1	UTSW	9	119110213	critical splice donor site	probably null
R6160:Dlec1	UTSW	9	119143319	missense	probably benign	0.02
R6195:Dlec1	UTSW	9	119137253	missense	probably benign	0.00
R6364:Dlec1	UTSW	9	119121871	missense	possibly damaging	0.84
R6480:Dlec1	UTSW	9	119147690	missense	probably benign	0.34
R6808:Dlec1	UTSW	9	119126174	missense	probably benign	0.01
R6813:Dlec1	UTSW	9	119112102	missense	probably benign	0.02
R7019:Dlec1	UTSW	9	119112422	missense	probably benign	0.01
R7048:Dlec1	UTSW	9	119143404	splice site	probably null
R7187:Dlec1	UTSW	9	119112146	missense	probably benign	0.14
R7230:Dlec1	UTSW	9	119124538	splice site	probably null
R7585:Dlec1	UTSW	9	119142751	missense	probably benign	0.06
R8342:Dlec1	UTSW	9	119139389	missense	probably benign	0.01
R8480:Dlec1	UTSW	9	119143267	splice site	probably null
R8481:Dlec1	UTSW	9	119143267	splice site	probably null
R8485:Dlec1	UTSW	9	119128591	missense	probably benign	0.33
R8520:Dlec1	UTSW	9	119112209	missense	probably benign	0.00
R8556:Dlec1	UTSW	9	119126221	missense	probably benign	0.13
R8755:Dlec1	UTSW	9	119138157	missense	probably damaging	1.00
R8805:Dlec1	UTSW	9	119112582	missense	probably benign
R8813:Dlec1	UTSW	9	119127430	missense	probably benign	0.16
R8983:Dlec1	UTSW	9	119128351	missense	probably benign	0.00
R9040:Dlec1	UTSW	9	119121917	missense	probably benign	0.04
R9085:Dlec1	UTSW	9	119124184	missense	probably damaging	1.00
R9452:Dlec1	UTSW	9	119112473	missense	probably benign	0.05
R9467:Dlec1	UTSW	9	119142584	missense	probably damaging	1.00
R9612:Dlec1	UTSW	9	119127465	missense	probably damaging	0.98
Z1176:Dlec1	UTSW	9	119138786	missense	probably benign	0.13
Z1177:Dlec1	UTSW	9	119134473	missense	probably benign	0.34
Z1177:Dlec1	UTSW	9	119147409	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTCAGATGGTCAGCAGCCAG -3'
(R):5'- TCAAAATCTCCGACCTCATTGG -3'

Sequencing Primer
(F):5'- GCAGAGCATCATATGATCCCTCGG -3'
(R):5'- ACCTCATTGGGCTCTGGAGAG -3'

Posted On

2015-08-18