Mutagenetix > Incidental Mutation

Incidental Mutation 'R4545:Vnn3'

333728

Institutional Source

Beutler Lab

Gene Symbol

Vnn3

Ensembl Gene

ENSMUSG00000020010

Gene Name

vanin 3

Synonyms

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.053) question?

Stock #

R4545 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

23851462-23869843 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 23856326 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 158 (R158H)

Ref Sequence

ENSEMBL: ENSMUSP00000020190 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020190]

AlphaFold

Q9QZ25

Predicted Effect

probably benign
Transcript: ENSMUST00000020190
AA Change: R158H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000020190
Gene: ENSMUSG00000020010
AA Change: R158H

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:CN_hydrolase	51	296	6.9e-19	PFAM

Meta Mutation Damage Score

0.1014

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

98% (41/42)

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akr1c20	A	C	13: 4,507,844	V201G	probably damaging	Het
Atf7	A	G	15: 102,534,327	V449A	probably benign	Het
Ccr1	G	A	9: 123,964,400	A31V	probably benign	Het
Chrna6	A	T	8: 27,406,683	S389T	probably benign	Het
Clic6	C	T	16: 92,492,157		probably benign	Het
Cmya5	G	A	13: 93,091,918	R2221*	probably null	Het
Coq8b	G	T	7: 27,233,505	C13F	probably benign	Het
Cspg4	T	A	9: 56,888,629	L1216Q	possibly damaging	Het
Decr1	C	A	4: 15,930,979	V118F	probably damaging	Het
Dlec1	A	T	9: 119,128,078	I796F	probably damaging	Het
Dnajc11	T	A	4: 151,979,941	D516E	probably damaging	Het
Dock8	G	A	19: 25,188,358	V1869M	probably damaging	Het
Dst	A	G	1: 34,188,738	D1982G	probably damaging	Het
Gm11808	C	T	4: 3,973,244	R106H	probably benign	Het
Gnptab	G	A	10: 88,414,595	D190N	probably benign	Het
Golga4	A	G	9: 118,556,845	K22E	probably damaging	Het
Hecw2	T	C	1: 53,813,222	*1579W	probably null	Het
Ica1l	A	G	1: 60,013,818		probably null	Het
Ift122	T	A	6: 115,890,588	L433Q	probably damaging	Het
Iqgap1	T	C	7: 80,762,567		probably null	Het
Klra13-ps	T	C	6: 130,291,269		noncoding transcript	Het
Mndal	A	T	1: 173,875,664	Y58*	probably null	Het
Mvb12b	G	C	2: 33,827,700	P172R	possibly damaging	Het
Ncapg	T	C	5: 45,671,212	F102L	probably damaging	Het
Olfr1447	T	A	19: 12,901,268	K171*	probably null	Het
Olfr235	T	C	19: 12,268,824	V198A	possibly damaging	Het
Olfr390	T	C	11: 73,787,166	V76A	probably damaging	Het
Pde8a	A	T	7: 81,328,099	R713S	probably damaging	Het
Rbks	T	C	5: 31,624,568	N296S	probably benign	Het
Sema3c	G	A	5: 17,694,772	V421I	probably benign	Het
Tm9sf1	A	G	14: 55,638,108	V393A	possibly damaging	Het
Tubgcp2	G	A	7: 139,996,071	P893L	possibly damaging	Het
Zfa-ps	G	T	10: 52,544,936		noncoding transcript	Het
Zfp414	T	C	17: 33,631,648		probably benign	Het
Zfp810	G	A	9: 22,278,745	T289I	probably damaging	Het
Zfp819	G	T	7: 43,617,785	R488L	probably damaging	Het
Zfp942	C	T	17: 21,928,304	G448D	probably benign	Het
Zscan12	A	G	13: 21,366,705	K165E	possibly damaging	Het

Other mutations in Vnn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00675:Vnn3	APN	10	23867168	missense	possibly damaging	0.77
IGL01300:Vnn3	APN	10	23864365	missense	possibly damaging	0.87
IGL01349:Vnn3	APN	10	23851916	missense	probably damaging	0.99
IGL02491:Vnn3	APN	10	23865918	missense	probably benign	0.11
IGL03256:Vnn3	APN	10	23851800	splice site	probably benign
IGL03289:Vnn3	APN	10	23865837	missense	possibly damaging	0.92
IGL02799:Vnn3	UTSW	10	23851971	missense	possibly damaging	0.64
R0599:Vnn3	UTSW	10	23865705	missense	possibly damaging	0.94
R1703:Vnn3	UTSW	10	23865930	missense	probably benign
R1753:Vnn3	UTSW	10	23865820	missense	probably benign	0.27
R2119:Vnn3	UTSW	10	23864413	missense	probably damaging	1.00
R2288:Vnn3	UTSW	10	23864456	missense	probably benign	0.03
R4255:Vnn3	UTSW	10	23865822	missense	probably benign	0.18
R4458:Vnn3	UTSW	10	23865669	missense	probably benign	0.23
R4518:Vnn3	UTSW	10	23867226	missense	possibly damaging	0.77
R4723:Vnn3	UTSW	10	23851691	missense	possibly damaging	0.88
R4791:Vnn3	UTSW	10	23864621	missense	probably benign
R4921:Vnn3	UTSW	10	23864575	missense	probably benign	0.01
R5152:Vnn3	UTSW	10	23864339	missense	probably benign	0.01
R5390:Vnn3	UTSW	10	23851585	start codon destroyed	probably null	1.00
R5545:Vnn3	UTSW	10	23867094	missense	probably benign	0.00
R6197:Vnn3	UTSW	10	23856289	missense	probably damaging	1.00
R6751:Vnn3	UTSW	10	23869625	missense	probably benign	0.00
R6846:Vnn3	UTSW	10	23851722	missense	probably benign
R6917:Vnn3	UTSW	10	23865934	missense	possibly damaging	0.50
R7073:Vnn3	UTSW	10	23864413	missense	probably damaging	1.00
R7100:Vnn3	UTSW	10	23865942	missense	probably damaging	1.00
R7152:Vnn3	UTSW	10	23851615	missense	possibly damaging	0.88
R7336:Vnn3	UTSW	10	23851908	missense	probably benign	0.42
R7421:Vnn3	UTSW	10	23865768	missense	probably benign	0.06
R7875:Vnn3	UTSW	10	23867248	missense	possibly damaging	0.80
R8353:Vnn3	UTSW	10	23869545	missense	probably benign	0.01
R8453:Vnn3	UTSW	10	23869545	missense	probably benign	0.01
R8465:Vnn3	UTSW	10	23865882	missense	possibly damaging	0.67
R9105:Vnn3	UTSW	10	23864563	missense	probably damaging	1.00
R9261:Vnn3	UTSW	10	23865709	missense	probably damaging	0.97
R9441:Vnn3	UTSW	10	23864600	missense	possibly damaging	0.94
R9718:Vnn3	UTSW	10	23869556	nonsense	probably null
R9737:Vnn3	UTSW	10	23865915	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- GTCATGGCATCCACTTGAGC -3'
(R):5'- ATTCACACAGAGAATCCTTAACTGG -3'

Sequencing Primer
(F):5'- GGCATCCACTTGAGCTAACATCTG -3'
(R):5'- ACACAGAGAATCCTTAACTGGTATAC -3'

Posted On

2015-08-18