Incidental Mutation 'R4545:Zfa-ps'
ID 333729
Institutional Source Beutler Lab
Gene Symbol Zfa-ps
Ensembl Gene ENSMUSG00000049576
Gene Name zinc finger protein, autosomal, pseudogene
Synonyms Zfa
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.253) question?
Stock # R4545 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 52418416-52421835 bp(-) (GRCm39)
Type of Mutation exon
DNA Base Change (assembly) G to T at 52421032 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180526
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180673
Meta Mutation Damage Score 0.0886 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 A C 13: 4,557,843 (GRCm39) V201G probably damaging Het
Atf7 A G 15: 102,442,762 (GRCm39) V449A probably benign Het
Ccr1 G A 9: 123,764,437 (GRCm39) A31V probably benign Het
Chrna6 A T 8: 27,896,711 (GRCm39) S389T probably benign Het
Clic6 C T 16: 92,289,045 (GRCm39) probably benign Het
Cmya5 G A 13: 93,228,426 (GRCm39) R2221* probably null Het
Coq8b G T 7: 26,932,930 (GRCm39) C13F probably benign Het
Cspg4 T A 9: 56,795,913 (GRCm39) L1216Q possibly damaging Het
Decr1 C A 4: 15,930,979 (GRCm39) V118F probably damaging Het
Dlec1 A T 9: 118,957,146 (GRCm39) I796F probably damaging Het
Dnajc11 T A 4: 152,064,398 (GRCm39) D516E probably damaging Het
Dock8 G A 19: 25,165,722 (GRCm39) V1869M probably damaging Het
Dst A G 1: 34,227,819 (GRCm39) D1982G probably damaging Het
Gnptab G A 10: 88,250,457 (GRCm39) D190N probably benign Het
Golga4 A G 9: 118,385,913 (GRCm39) K22E probably damaging Het
Hecw2 T C 1: 53,852,381 (GRCm39) *1579W probably null Het
Ica1l A G 1: 60,052,977 (GRCm39) probably null Het
Ift122 T A 6: 115,867,549 (GRCm39) L433Q probably damaging Het
Iqgap1 T C 7: 80,412,315 (GRCm39) probably null Het
Klra13-ps T C 6: 130,268,232 (GRCm39) noncoding transcript Het
Mndal A T 1: 173,703,230 (GRCm39) Y58* probably null Het
Mvb12b G C 2: 33,717,712 (GRCm39) P172R possibly damaging Het
Ncapg T C 5: 45,828,554 (GRCm39) F102L probably damaging Het
Or1e30 T C 11: 73,677,992 (GRCm39) V76A probably damaging Het
Or5an11 T C 19: 12,246,188 (GRCm39) V198A possibly damaging Het
Or5b97 T A 19: 12,878,632 (GRCm39) K171* probably null Het
Pde8a A T 7: 80,977,847 (GRCm39) R713S probably damaging Het
Rbks T C 5: 31,781,912 (GRCm39) N296S probably benign Het
Sema3c G A 5: 17,899,770 (GRCm39) V421I probably benign Het
Tm9sf1 A G 14: 55,875,565 (GRCm39) V393A possibly damaging Het
Tubgcp2 G A 7: 139,575,984 (GRCm39) P893L possibly damaging Het
Uba52rt C T 4: 3,973,244 (GRCm39) R106H probably benign Het
Vnn3 G A 10: 23,732,224 (GRCm39) R158H probably benign Het
Zfp414 T C 17: 33,850,622 (GRCm39) probably benign Het
Zfp810 G A 9: 22,190,041 (GRCm39) T289I probably damaging Het
Zfp819 G T 7: 43,267,209 (GRCm39) R488L probably damaging Het
Zfp942 C T 17: 22,147,285 (GRCm39) G448D probably benign Het
Zscan12 A G 13: 21,550,875 (GRCm39) K165E possibly damaging Het
Other mutations in Zfa-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Zfa-ps APN 10 52,420,043 (GRCm39) exon noncoding transcript
R0057:Zfa-ps UTSW 10 52,421,202 (GRCm39) exon noncoding transcript
R0057:Zfa-ps UTSW 10 52,421,202 (GRCm39) exon noncoding transcript
R1159:Zfa-ps UTSW 10 52,419,654 (GRCm39) exon noncoding transcript
R2145:Zfa-ps UTSW 10 52,419,373 (GRCm39) exon noncoding transcript
R2290:Zfa-ps UTSW 10 52,421,112 (GRCm39) exon noncoding transcript
R2509:Zfa-ps UTSW 10 52,420,339 (GRCm39) exon noncoding transcript
R3738:Zfa-ps UTSW 10 52,420,636 (GRCm39) exon noncoding transcript
R4035:Zfa-ps UTSW 10 52,420,636 (GRCm39) exon noncoding transcript
R4290:Zfa-ps UTSW 10 52,419,807 (GRCm39) exon noncoding transcript
R4862:Zfa-ps UTSW 10 52,419,192 (GRCm39) exon noncoding transcript
R5135:Zfa-ps UTSW 10 52,419,118 (GRCm39) exon noncoding transcript
R5270:Zfa-ps UTSW 10 52,419,552 (GRCm39) exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- ACAACATCAGTGGCCAGAGG -3'
(R):5'- GTTCAAGAAACGGTTTATGTGTCAG -3'

Sequencing Primer
(F):5'- CATCAGTGGCCAGAGGATCTGTG -3'
(R):5'- TGTCAGATGTTGTAGATTCCGAC -3'
Posted On 2015-08-18