Incidental Mutation 'R4545:Zfa-ps'
ID 333729
Institutional Source Beutler Lab
Gene Symbol Zfa-ps
Ensembl Gene ENSMUSG00000049576
Gene Name zinc finger protein, autosomal, pseudogene
Synonyms Zfa
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock # R4545 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 52542320-52545739 bp(-) (GRCm38)
Type of Mutation exon
DNA Base Change (assembly) G to T at 52544936 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180526
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180673
Meta Mutation Damage Score 0.0886 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Atf7 A G 15: 102,534,327 V449A probably benign Het
Ccr1 G A 9: 123,964,400 A31V probably benign Het
Chrna6 A T 8: 27,406,683 S389T probably benign Het
Clic6 C T 16: 92,492,157 probably benign Het
Cmya5 G A 13: 93,091,918 R2221* probably null Het
Coq8b G T 7: 27,233,505 C13F probably benign Het
Cspg4 T A 9: 56,888,629 L1216Q possibly damaging Het
Decr1 C A 4: 15,930,979 V118F probably damaging Het
Dlec1 A T 9: 119,128,078 I796F probably damaging Het
Dnajc11 T A 4: 151,979,941 D516E probably damaging Het
Dock8 G A 19: 25,188,358 V1869M probably damaging Het
Dst A G 1: 34,188,738 D1982G probably damaging Het
Gm11808 C T 4: 3,973,244 R106H probably benign Het
Gnptab G A 10: 88,414,595 D190N probably benign Het
Golga4 A G 9: 118,556,845 K22E probably damaging Het
Hecw2 T C 1: 53,813,222 *1579W probably null Het
Ica1l A G 1: 60,013,818 probably null Het
Ift122 T A 6: 115,890,588 L433Q probably damaging Het
Iqgap1 T C 7: 80,762,567 probably null Het
Klra13-ps T C 6: 130,291,269 noncoding transcript Het
Mndal A T 1: 173,875,664 Y58* probably null Het
Mvb12b G C 2: 33,827,700 P172R possibly damaging Het
Ncapg T C 5: 45,671,212 F102L probably damaging Het
Olfr1447 T A 19: 12,901,268 K171* probably null Het
Olfr235 T C 19: 12,268,824 V198A possibly damaging Het
Olfr390 T C 11: 73,787,166 V76A probably damaging Het
Pde8a A T 7: 81,328,099 R713S probably damaging Het
Rbks T C 5: 31,624,568 N296S probably benign Het
Sema3c G A 5: 17,694,772 V421I probably benign Het
Tm9sf1 A G 14: 55,638,108 V393A possibly damaging Het
Tubgcp2 G A 7: 139,996,071 P893L possibly damaging Het
Vnn3 G A 10: 23,856,326 R158H probably benign Het
Zfp414 T C 17: 33,631,648 probably benign Het
Zfp810 G A 9: 22,278,745 T289I probably damaging Het
Zfp819 G T 7: 43,617,785 R488L probably damaging Het
Zfp942 C T 17: 21,928,304 G448D probably benign Het
Zscan12 A G 13: 21,366,705 K165E possibly damaging Het
Other mutations in Zfa-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Zfa-ps APN 10 52543947 exon noncoding transcript
R0057:Zfa-ps UTSW 10 52545106 exon noncoding transcript
R0057:Zfa-ps UTSW 10 52545106 exon noncoding transcript
R1159:Zfa-ps UTSW 10 52543558 exon noncoding transcript
R2145:Zfa-ps UTSW 10 52543277 exon noncoding transcript
R2290:Zfa-ps UTSW 10 52545016 exon noncoding transcript
R2509:Zfa-ps UTSW 10 52544243 exon noncoding transcript
R3738:Zfa-ps UTSW 10 52544540 exon noncoding transcript
R4035:Zfa-ps UTSW 10 52544540 exon noncoding transcript
R4290:Zfa-ps UTSW 10 52543711 exon noncoding transcript
R4862:Zfa-ps UTSW 10 52543096 exon noncoding transcript
R5135:Zfa-ps UTSW 10 52543022 exon noncoding transcript
R5270:Zfa-ps UTSW 10 52543456 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- ACAACATCAGTGGCCAGAGG -3'
(R):5'- GTTCAAGAAACGGTTTATGTGTCAG -3'

Sequencing Primer
(F):5'- CATCAGTGGCCAGAGGATCTGTG -3'
(R):5'- TGTCAGATGTTGTAGATTCCGAC -3'
Posted On 2015-08-18