Mutagenetix > Incidental Mutation

Incidental Mutation 'R4545:Gnptab'

333730

Institutional Source

Beutler Lab

Gene Symbol

Gnptab

Ensembl Gene

ENSMUSG00000035311

Gene Name

N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits

Synonyms

EG432486

Accession Numbers

Essential gene?

Probably essential (E-score: 0.956) question?

Stock #

R4545 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

88379132-88447329 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 88414595 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 190 (D190N)

Ref Sequence

ENSEMBL: ENSMUSP00000020251 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020251] [ENSMUST00000127615] [ENSMUST00000130301] [ENSMUST00000151273]

AlphaFold

Q69ZN6

Predicted Effect

probably benign
Transcript: ENSMUST00000020251
AA Change: D190N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000020251
Gene: ENSMUSG00000035311
AA Change: D190N

Domain	Start	End	E-Value	Type
transmembrane domain	20	42	N/A	INTRINSIC
Pfam:Stealth_CR1	73	101	6.6e-14	PFAM
Pfam:Stealth_CR2	322	429	8.8e-49	PFAM
NL	431	469	3.82e-7	SMART
low complexity region	480	490	N/A	INTRINSIC
NL	498	536	2.37e-2	SMART
DMAP_binding	699	813	6.14e-38	SMART
Pfam:Stealth_CR3	934	982	2.9e-21	PFAM
Pfam:Stealth_CR4	1117	1173	7.9e-28	PFAM
transmembrane domain	1192	1214	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000127615
AA Change: D174N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000116915
Gene: ENSMUSG00000035311
AA Change: D174N

Domain	Start	End	E-Value	Type
transmembrane domain	2	24	N/A	INTRINSIC
coiled coil region	71	98	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000130301

SMART Domains

Protein: ENSMUSP00000120643
Gene: ENSMUSG00000035311

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
coiled coil region	77	104	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000151273

SMART Domains

Protein: ENSMUSP00000118025
Gene: ENSMUSG00000035311

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC

Meta Mutation Damage Score

0.0610

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

98% (41/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes two of three subunit types of the membrane-bound enzyme N-acetylglucosamine-1-phosphotransferase, a heterohexameric complex composed of two alpha, two beta, and two gamma subunits. The encoded protein is proteolytically cleaved at the Lys928-Asp929 bond to yield mature alpha and beta polypeptides while the gamma subunits are the product of a distinct gene (GeneID 84572). In the Golgi apparatus, the heterohexameric complex catalyzes the first step in the synthesis of mannose 6-phosphate recognition markers on certain oligosaccharides of newly synthesized lysosomal enzymes. These recognition markers are essential for appropriate trafficking of lysosomal enzymes. Mutations in this gene have been associated with both mucolipidosis II and mucolipidosis IIIA.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutations cause stunted growth, high lysosomal enzyme levels, skeletal defects, retinal degeneration and secretory cell lesions. Homozygotes for an ENU allele show skeletal and facial defects, altered enzymatic activities, lysosomal storage, Purkinje cell loss, ataxia and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akr1c20	A	C	13: 4,507,844	V201G	probably damaging	Het
Atf7	A	G	15: 102,534,327	V449A	probably benign	Het
Ccr1	G	A	9: 123,964,400	A31V	probably benign	Het
Chrna6	A	T	8: 27,406,683	S389T	probably benign	Het
Clic6	C	T	16: 92,492,157		probably benign	Het
Cmya5	G	A	13: 93,091,918	R2221*	probably null	Het
Coq8b	G	T	7: 27,233,505	C13F	probably benign	Het
Cspg4	T	A	9: 56,888,629	L1216Q	possibly damaging	Het
Decr1	C	A	4: 15,930,979	V118F	probably damaging	Het
Dlec1	A	T	9: 119,128,078	I796F	probably damaging	Het
Dnajc11	T	A	4: 151,979,941	D516E	probably damaging	Het
Dock8	G	A	19: 25,188,358	V1869M	probably damaging	Het
Dst	A	G	1: 34,188,738	D1982G	probably damaging	Het
Gm11808	C	T	4: 3,973,244	R106H	probably benign	Het
Golga4	A	G	9: 118,556,845	K22E	probably damaging	Het
Hecw2	T	C	1: 53,813,222	*1579W	probably null	Het
Ica1l	A	G	1: 60,013,818		probably null	Het
Ift122	T	A	6: 115,890,588	L433Q	probably damaging	Het
Iqgap1	T	C	7: 80,762,567		probably null	Het
Klra13-ps	T	C	6: 130,291,269		noncoding transcript	Het
Mndal	A	T	1: 173,875,664	Y58*	probably null	Het
Mvb12b	G	C	2: 33,827,700	P172R	possibly damaging	Het
Ncapg	T	C	5: 45,671,212	F102L	probably damaging	Het
Olfr1447	T	A	19: 12,901,268	K171*	probably null	Het
Olfr235	T	C	19: 12,268,824	V198A	possibly damaging	Het
Olfr390	T	C	11: 73,787,166	V76A	probably damaging	Het
Pde8a	A	T	7: 81,328,099	R713S	probably damaging	Het
Rbks	T	C	5: 31,624,568	N296S	probably benign	Het
Sema3c	G	A	5: 17,694,772	V421I	probably benign	Het
Tm9sf1	A	G	14: 55,638,108	V393A	possibly damaging	Het
Tubgcp2	G	A	7: 139,996,071	P893L	possibly damaging	Het
Vnn3	G	A	10: 23,856,326	R158H	probably benign	Het
Zfa-ps	G	T	10: 52,544,936		noncoding transcript	Het
Zfp414	T	C	17: 33,631,648		probably benign	Het
Zfp810	G	A	9: 22,278,745	T289I	probably damaging	Het
Zfp819	G	T	7: 43,617,785	R488L	probably damaging	Het
Zfp942	C	T	17: 21,928,304	G448D	probably benign	Het
Zscan12	A	G	13: 21,366,705	K165E	possibly damaging	Het

Other mutations in Gnptab

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01326:Gnptab	APN	10	88433065	missense	probably damaging	0.99
IGL01346:Gnptab	APN	10	88436179	missense	possibly damaging	0.65
IGL01626:Gnptab	APN	10	88437495	missense	probably damaging	0.98
IGL01642:Gnptab	APN	10	88436132	missense	possibly damaging	0.89
IGL02121:Gnptab	APN	10	88429461	missense	possibly damaging	0.90
IGL03076:Gnptab	APN	10	88440289	missense	possibly damaging	0.91
IGL03130:Gnptab	APN	10	88436371	missense	possibly damaging	0.95
maze	UTSW	10	88432573	missense	probably damaging	1.00
R0103:Gnptab	UTSW	10	88429519	missense	probably damaging	1.00
R0103:Gnptab	UTSW	10	88429519	missense	probably damaging	1.00
R0114:Gnptab	UTSW	10	88433400	missense	possibly damaging	0.48
R0206:Gnptab	UTSW	10	88439510	missense	probably damaging	0.98
R0288:Gnptab	UTSW	10	88433105	missense	probably benign	0.00
R0329:Gnptab	UTSW	10	88440309	missense	probably damaging	1.00
R0330:Gnptab	UTSW	10	88440309	missense	probably damaging	1.00
R0369:Gnptab	UTSW	10	88433594	missense	possibly damaging	0.87
R0385:Gnptab	UTSW	10	88436525	missense	probably damaging	1.00
R0522:Gnptab	UTSW	10	88431466	splice site	probably benign
R0569:Gnptab	UTSW	10	88428557	missense	possibly damaging	0.89
R0671:Gnptab	UTSW	10	88443304	splice site	probably benign
R0834:Gnptab	UTSW	10	88429952	missense	probably damaging	1.00
R1375:Gnptab	UTSW	10	88432573	missense	probably damaging	1.00
R1443:Gnptab	UTSW	10	88434081	missense	probably damaging	1.00
R1464:Gnptab	UTSW	10	88445754	splice site	probably benign
R1471:Gnptab	UTSW	10	88445763	missense	probably benign
R1570:Gnptab	UTSW	10	88419454	missense	probably damaging	0.99
R1612:Gnptab	UTSW	10	88428482	splice site	probably null
R1614:Gnptab	UTSW	10	88414589	missense	probably benign
R1638:Gnptab	UTSW	10	88436167	missense	possibly damaging	0.94
R1739:Gnptab	UTSW	10	88436095	missense	probably benign	0.14
R1894:Gnptab	UTSW	10	88419127	missense	possibly damaging	0.69
R2092:Gnptab	UTSW	10	88440305	nonsense	probably null
R2118:Gnptab	UTSW	10	88436398	missense	probably benign	0.13
R2144:Gnptab	UTSW	10	88428506	missense	possibly damaging	0.89
R2174:Gnptab	UTSW	10	88434044	missense	probably damaging	1.00
R3847:Gnptab	UTSW	10	88433577	nonsense	probably null
R3943:Gnptab	UTSW	10	88433894	missense	probably benign
R4434:Gnptab	UTSW	10	88412622	missense	probably damaging	1.00
R4776:Gnptab	UTSW	10	88436528	missense	probably damaging	1.00
R4786:Gnptab	UTSW	10	88436182	missense	probably damaging	1.00
R4880:Gnptab	UTSW	10	88432551	nonsense	probably null
R4889:Gnptab	UTSW	10	88433913	missense	probably benign	0.00
R4923:Gnptab	UTSW	10	88429623	missense	probably benign	0.17
R5694:Gnptab	UTSW	10	88414486	missense	probably benign	0.01
R5943:Gnptab	UTSW	10	88433514	missense	probably benign	0.00
R6027:Gnptab	UTSW	10	88433225	missense	probably damaging	0.98
R6074:Gnptab	UTSW	10	88433078	missense	probably damaging	1.00
R6119:Gnptab	UTSW	10	88431395	missense	probably damaging	1.00
R6182:Gnptab	UTSW	10	88429480	missense	possibly damaging	0.71
R6757:Gnptab	UTSW	10	88437502	missense	probably damaging	0.98
R6910:Gnptab	UTSW	10	88431396	missense	probably damaging	1.00
R6911:Gnptab	UTSW	10	88431396	missense	probably damaging	1.00
R7094:Gnptab	UTSW	10	88379504	missense	possibly damaging	0.66
R7101:Gnptab	UTSW	10	88440312	missense	probably benign	0.19
R7164:Gnptab	UTSW	10	88434070	nonsense	probably null
R7214:Gnptab	UTSW	10	88379157	unclassified	probably benign
R7316:Gnptab	UTSW	10	88400710	missense	probably damaging	1.00
R7463:Gnptab	UTSW	10	88431389	missense	probably damaging	1.00
R7596:Gnptab	UTSW	10	88443370	missense	probably damaging	0.99
R7654:Gnptab	UTSW	10	88445819	missense	possibly damaging	0.63
R7722:Gnptab	UTSW	10	88379528	missense	probably damaging	0.99
R7770:Gnptab	UTSW	10	88411920	missense	probably benign	0.41
R7791:Gnptab	UTSW	10	88440222	critical splice acceptor site	probably null
R7838:Gnptab	UTSW	10	88440392	critical splice donor site	probably null
R8002:Gnptab	UTSW	10	88440268	missense	probably benign	0.14
R8168:Gnptab	UTSW	10	88419133	missense	probably benign	0.41
R8219:Gnptab	UTSW	10	88433792	missense	probably benign
R8221:Gnptab	UTSW	10	88440392	critical splice donor site	probably null
R8313:Gnptab	UTSW	10	88439209	missense	probably damaging	1.00
R8351:Gnptab	UTSW	10	88414486	missense	probably benign	0.01
R8487:Gnptab	UTSW	10	88432646	critical splice donor site	probably null
R9108:Gnptab	UTSW	10	88433538	missense
R9352:Gnptab	UTSW	10	88432488	missense	probably benign	0.05
R9489:Gnptab	UTSW	10	88433130	missense	probably damaging	1.00
R9598:Gnptab	UTSW	10	88412014	missense	probably damaging	0.97
R9760:Gnptab	UTSW	10	88431448	missense	probably damaging	1.00
R9771:Gnptab	UTSW	10	88432623	missense	probably damaging	1.00
X0064:Gnptab	UTSW	10	88436530	missense	probably damaging	1.00
X0066:Gnptab	UTSW	10	88412011	missense	probably damaging	0.99
Z1176:Gnptab	UTSW	10	88431368	missense	probably damaging	1.00
Z1177:Gnptab	UTSW	10	88440270	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCTGACGCACTGCATTAAG -3'
(R):5'- CAAGCATTTCTCACAGAGTCATTTG -3'

Sequencing Primer
(F):5'- ACTGCATTAAGGTGCCCATG -3'
(R):5'- GACCTGGGTTCAGATTCTAAGACC -3'

Posted On

2015-08-18