Incidental Mutation 'R4545:Gnptab'
ID 333730
Institutional Source Beutler Lab
Gene Symbol Gnptab
Ensembl Gene ENSMUSG00000035311
Gene Name N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
Synonyms EG432486
Accession Numbers
Essential gene? Probably essential (E-score: 0.924) question?
Stock # R4545 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 88214996-88283186 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 88250457 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 190 (D190N)
Ref Sequence ENSEMBL: ENSMUSP00000020251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020251] [ENSMUST00000127615] [ENSMUST00000130301] [ENSMUST00000151273]
AlphaFold Q69ZN6
Predicted Effect probably benign
Transcript: ENSMUST00000020251
AA Change: D190N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000020251
Gene: ENSMUSG00000035311
AA Change: D190N

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Stealth_CR1 73 101 6.6e-14 PFAM
Pfam:Stealth_CR2 322 429 8.8e-49 PFAM
NL 431 469 3.82e-7 SMART
low complexity region 480 490 N/A INTRINSIC
NL 498 536 2.37e-2 SMART
DMAP_binding 699 813 6.14e-38 SMART
Pfam:Stealth_CR3 934 982 2.9e-21 PFAM
Pfam:Stealth_CR4 1117 1173 7.9e-28 PFAM
transmembrane domain 1192 1214 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127615
AA Change: D174N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000116915
Gene: ENSMUSG00000035311
AA Change: D174N

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
coiled coil region 71 98 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130301
SMART Domains Protein: ENSMUSP00000120643
Gene: ENSMUSG00000035311

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
coiled coil region 77 104 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151273
SMART Domains Protein: ENSMUSP00000118025
Gene: ENSMUSG00000035311

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Meta Mutation Damage Score 0.0610 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes two of three subunit types of the membrane-bound enzyme N-acetylglucosamine-1-phosphotransferase, a heterohexameric complex composed of two alpha, two beta, and two gamma subunits. The encoded protein is proteolytically cleaved at the Lys928-Asp929 bond to yield mature alpha and beta polypeptides while the gamma subunits are the product of a distinct gene (GeneID 84572). In the Golgi apparatus, the heterohexameric complex catalyzes the first step in the synthesis of mannose 6-phosphate recognition markers on certain oligosaccharides of newly synthesized lysosomal enzymes. These recognition markers are essential for appropriate trafficking of lysosomal enzymes. Mutations in this gene have been associated with both mucolipidosis II and mucolipidosis IIIA.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutations cause stunted growth, high lysosomal enzyme levels, skeletal defects, retinal degeneration and secretory cell lesions. Homozygotes for an ENU allele show skeletal and facial defects, altered enzymatic activities, lysosomal storage, Purkinje cell loss, ataxia and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 A C 13: 4,557,843 (GRCm39) V201G probably damaging Het
Atf7 A G 15: 102,442,762 (GRCm39) V449A probably benign Het
Ccr1 G A 9: 123,764,437 (GRCm39) A31V probably benign Het
Chrna6 A T 8: 27,896,711 (GRCm39) S389T probably benign Het
Clic6 C T 16: 92,289,045 (GRCm39) probably benign Het
Cmya5 G A 13: 93,228,426 (GRCm39) R2221* probably null Het
Coq8b G T 7: 26,932,930 (GRCm39) C13F probably benign Het
Cspg4 T A 9: 56,795,913 (GRCm39) L1216Q possibly damaging Het
Decr1 C A 4: 15,930,979 (GRCm39) V118F probably damaging Het
Dlec1 A T 9: 118,957,146 (GRCm39) I796F probably damaging Het
Dnajc11 T A 4: 152,064,398 (GRCm39) D516E probably damaging Het
Dock8 G A 19: 25,165,722 (GRCm39) V1869M probably damaging Het
Dst A G 1: 34,227,819 (GRCm39) D1982G probably damaging Het
Golga4 A G 9: 118,385,913 (GRCm39) K22E probably damaging Het
Hecw2 T C 1: 53,852,381 (GRCm39) *1579W probably null Het
Ica1l A G 1: 60,052,977 (GRCm39) probably null Het
Ift122 T A 6: 115,867,549 (GRCm39) L433Q probably damaging Het
Iqgap1 T C 7: 80,412,315 (GRCm39) probably null Het
Klra13-ps T C 6: 130,268,232 (GRCm39) noncoding transcript Het
Mndal A T 1: 173,703,230 (GRCm39) Y58* probably null Het
Mvb12b G C 2: 33,717,712 (GRCm39) P172R possibly damaging Het
Ncapg T C 5: 45,828,554 (GRCm39) F102L probably damaging Het
Or1e30 T C 11: 73,677,992 (GRCm39) V76A probably damaging Het
Or5an11 T C 19: 12,246,188 (GRCm39) V198A possibly damaging Het
Or5b97 T A 19: 12,878,632 (GRCm39) K171* probably null Het
Pde8a A T 7: 80,977,847 (GRCm39) R713S probably damaging Het
Rbks T C 5: 31,781,912 (GRCm39) N296S probably benign Het
Sema3c G A 5: 17,899,770 (GRCm39) V421I probably benign Het
Tm9sf1 A G 14: 55,875,565 (GRCm39) V393A possibly damaging Het
Tubgcp2 G A 7: 139,575,984 (GRCm39) P893L possibly damaging Het
Uba52rt C T 4: 3,973,244 (GRCm39) R106H probably benign Het
Vnn3 G A 10: 23,732,224 (GRCm39) R158H probably benign Het
Zfa-ps G T 10: 52,421,032 (GRCm39) noncoding transcript Het
Zfp414 T C 17: 33,850,622 (GRCm39) probably benign Het
Zfp810 G A 9: 22,190,041 (GRCm39) T289I probably damaging Het
Zfp819 G T 7: 43,267,209 (GRCm39) R488L probably damaging Het
Zfp942 C T 17: 22,147,285 (GRCm39) G448D probably benign Het
Zscan12 A G 13: 21,550,875 (GRCm39) K165E possibly damaging Het
Other mutations in Gnptab
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Gnptab APN 10 88,268,927 (GRCm39) missense probably damaging 0.99
IGL01346:Gnptab APN 10 88,272,041 (GRCm39) missense possibly damaging 0.65
IGL01626:Gnptab APN 10 88,273,357 (GRCm39) missense probably damaging 0.98
IGL01642:Gnptab APN 10 88,271,994 (GRCm39) missense possibly damaging 0.89
IGL02121:Gnptab APN 10 88,265,323 (GRCm39) missense possibly damaging 0.90
IGL03076:Gnptab APN 10 88,276,151 (GRCm39) missense possibly damaging 0.91
IGL03130:Gnptab APN 10 88,272,233 (GRCm39) missense possibly damaging 0.95
maze UTSW 10 88,268,435 (GRCm39) missense probably damaging 1.00
R0103:Gnptab UTSW 10 88,265,381 (GRCm39) missense probably damaging 1.00
R0103:Gnptab UTSW 10 88,265,381 (GRCm39) missense probably damaging 1.00
R0114:Gnptab UTSW 10 88,269,262 (GRCm39) missense possibly damaging 0.48
R0206:Gnptab UTSW 10 88,275,372 (GRCm39) missense probably damaging 0.98
R0288:Gnptab UTSW 10 88,268,967 (GRCm39) missense probably benign 0.00
R0329:Gnptab UTSW 10 88,276,171 (GRCm39) missense probably damaging 1.00
R0330:Gnptab UTSW 10 88,276,171 (GRCm39) missense probably damaging 1.00
R0369:Gnptab UTSW 10 88,269,456 (GRCm39) missense possibly damaging 0.87
R0385:Gnptab UTSW 10 88,272,387 (GRCm39) missense probably damaging 1.00
R0522:Gnptab UTSW 10 88,267,328 (GRCm39) splice site probably benign
R0569:Gnptab UTSW 10 88,264,419 (GRCm39) missense possibly damaging 0.89
R0671:Gnptab UTSW 10 88,279,166 (GRCm39) splice site probably benign
R0834:Gnptab UTSW 10 88,265,814 (GRCm39) missense probably damaging 1.00
R1375:Gnptab UTSW 10 88,268,435 (GRCm39) missense probably damaging 1.00
R1443:Gnptab UTSW 10 88,269,943 (GRCm39) missense probably damaging 1.00
R1464:Gnptab UTSW 10 88,281,616 (GRCm39) splice site probably benign
R1471:Gnptab UTSW 10 88,281,625 (GRCm39) missense probably benign
R1570:Gnptab UTSW 10 88,255,316 (GRCm39) missense probably damaging 0.99
R1612:Gnptab UTSW 10 88,264,344 (GRCm39) splice site probably null
R1614:Gnptab UTSW 10 88,250,451 (GRCm39) missense probably benign
R1638:Gnptab UTSW 10 88,272,029 (GRCm39) missense possibly damaging 0.94
R1739:Gnptab UTSW 10 88,271,957 (GRCm39) missense probably benign 0.14
R1894:Gnptab UTSW 10 88,254,989 (GRCm39) missense possibly damaging 0.69
R2092:Gnptab UTSW 10 88,276,167 (GRCm39) nonsense probably null
R2118:Gnptab UTSW 10 88,272,260 (GRCm39) missense probably benign 0.13
R2144:Gnptab UTSW 10 88,264,368 (GRCm39) missense possibly damaging 0.89
R2174:Gnptab UTSW 10 88,269,906 (GRCm39) missense probably damaging 1.00
R3847:Gnptab UTSW 10 88,269,439 (GRCm39) nonsense probably null
R3943:Gnptab UTSW 10 88,269,756 (GRCm39) missense probably benign
R4434:Gnptab UTSW 10 88,248,484 (GRCm39) missense probably damaging 1.00
R4776:Gnptab UTSW 10 88,272,390 (GRCm39) missense probably damaging 1.00
R4786:Gnptab UTSW 10 88,272,044 (GRCm39) missense probably damaging 1.00
R4880:Gnptab UTSW 10 88,268,413 (GRCm39) nonsense probably null
R4889:Gnptab UTSW 10 88,269,775 (GRCm39) missense probably benign 0.00
R4923:Gnptab UTSW 10 88,265,485 (GRCm39) missense probably benign 0.17
R5694:Gnptab UTSW 10 88,250,348 (GRCm39) missense probably benign 0.01
R5943:Gnptab UTSW 10 88,269,376 (GRCm39) missense probably benign 0.00
R6027:Gnptab UTSW 10 88,269,087 (GRCm39) missense probably damaging 0.98
R6074:Gnptab UTSW 10 88,268,940 (GRCm39) missense probably damaging 1.00
R6119:Gnptab UTSW 10 88,267,257 (GRCm39) missense probably damaging 1.00
R6182:Gnptab UTSW 10 88,265,342 (GRCm39) missense possibly damaging 0.71
R6757:Gnptab UTSW 10 88,273,364 (GRCm39) missense probably damaging 0.98
R6910:Gnptab UTSW 10 88,267,258 (GRCm39) missense probably damaging 1.00
R6911:Gnptab UTSW 10 88,267,258 (GRCm39) missense probably damaging 1.00
R7094:Gnptab UTSW 10 88,215,366 (GRCm39) missense possibly damaging 0.66
R7101:Gnptab UTSW 10 88,276,174 (GRCm39) missense probably benign 0.19
R7164:Gnptab UTSW 10 88,269,932 (GRCm39) nonsense probably null
R7214:Gnptab UTSW 10 88,215,019 (GRCm39) unclassified probably benign
R7316:Gnptab UTSW 10 88,236,572 (GRCm39) missense probably damaging 1.00
R7463:Gnptab UTSW 10 88,267,251 (GRCm39) missense probably damaging 1.00
R7596:Gnptab UTSW 10 88,279,232 (GRCm39) missense probably damaging 0.99
R7654:Gnptab UTSW 10 88,281,681 (GRCm39) missense possibly damaging 0.63
R7722:Gnptab UTSW 10 88,215,390 (GRCm39) missense probably damaging 0.99
R7770:Gnptab UTSW 10 88,247,782 (GRCm39) missense probably benign 0.41
R7791:Gnptab UTSW 10 88,276,084 (GRCm39) critical splice acceptor site probably null
R7838:Gnptab UTSW 10 88,276,254 (GRCm39) critical splice donor site probably null
R8002:Gnptab UTSW 10 88,276,130 (GRCm39) missense probably benign 0.14
R8168:Gnptab UTSW 10 88,254,995 (GRCm39) missense probably benign 0.41
R8219:Gnptab UTSW 10 88,269,654 (GRCm39) missense probably benign
R8221:Gnptab UTSW 10 88,276,254 (GRCm39) critical splice donor site probably null
R8313:Gnptab UTSW 10 88,275,071 (GRCm39) missense probably damaging 1.00
R8351:Gnptab UTSW 10 88,250,348 (GRCm39) missense probably benign 0.01
R8487:Gnptab UTSW 10 88,268,508 (GRCm39) critical splice donor site probably null
R9108:Gnptab UTSW 10 88,269,400 (GRCm39) missense
R9352:Gnptab UTSW 10 88,268,350 (GRCm39) missense probably benign 0.05
R9489:Gnptab UTSW 10 88,268,992 (GRCm39) missense probably damaging 1.00
R9598:Gnptab UTSW 10 88,247,876 (GRCm39) missense probably damaging 0.97
R9760:Gnptab UTSW 10 88,267,310 (GRCm39) missense probably damaging 1.00
R9771:Gnptab UTSW 10 88,268,485 (GRCm39) missense probably damaging 1.00
X0064:Gnptab UTSW 10 88,272,392 (GRCm39) missense probably damaging 1.00
X0066:Gnptab UTSW 10 88,247,873 (GRCm39) missense probably damaging 0.99
Z1176:Gnptab UTSW 10 88,267,230 (GRCm39) missense probably damaging 1.00
Z1177:Gnptab UTSW 10 88,276,132 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGACGCACTGCATTAAG -3'
(R):5'- CAAGCATTTCTCACAGAGTCATTTG -3'

Sequencing Primer
(F):5'- ACTGCATTAAGGTGCCCATG -3'
(R):5'- GACCTGGGTTCAGATTCTAAGACC -3'
Posted On 2015-08-18