Incidental Mutation 'R4545:Olfr390'
ID 333731
Institutional Source Beutler Lab
Gene Symbol Olfr390
Ensembl Gene ENSMUSG00000069818
Gene Name olfactory receptor 390
Synonyms MOR135-26, GA_x6K02T2P1NL-3938806-3939741
Accession Numbers
Essential gene? Probably non essential (E-score: 0.089) question?
Stock # R4545 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 73782964-73790446 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 73787166 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 76 (V76A)
Ref Sequence ENSEMBL: ENSMUSP00000146162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092919] [ENSMUST00000120081] [ENSMUST00000206815] [ENSMUST00000215161]
AlphaFold Q8VEZ7
Predicted Effect possibly damaging
Transcript: ENSMUST00000092919
AA Change: V76A

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000090598
Gene: ENSMUSG00000069818
AA Change: V76A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.1e-61 PFAM
Pfam:7TM_GPCR_Srsx 35 305 7.2e-9 PFAM
Pfam:7tm_1 41 290 6.8e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120081
AA Change: V76A

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113472
Gene: ENSMUSG00000069818
AA Change: V76A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 305 7.2e-9 PFAM
Pfam:7tm_1 41 290 1.4e-36 PFAM
Pfam:7tm_4 139 283 5.6e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000206815
AA Change: V76A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215161
AA Change: V76A

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.3386 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Atf7 A G 15: 102,534,327 V449A probably benign Het
Ccr1 G A 9: 123,964,400 A31V probably benign Het
Chrna6 A T 8: 27,406,683 S389T probably benign Het
Clic6 C T 16: 92,492,157 probably benign Het
Cmya5 G A 13: 93,091,918 R2221* probably null Het
Coq8b G T 7: 27,233,505 C13F probably benign Het
Cspg4 T A 9: 56,888,629 L1216Q possibly damaging Het
Decr1 C A 4: 15,930,979 V118F probably damaging Het
Dlec1 A T 9: 119,128,078 I796F probably damaging Het
Dnajc11 T A 4: 151,979,941 D516E probably damaging Het
Dock8 G A 19: 25,188,358 V1869M probably damaging Het
Dst A G 1: 34,188,738 D1982G probably damaging Het
Gm11808 C T 4: 3,973,244 R106H probably benign Het
Gnptab G A 10: 88,414,595 D190N probably benign Het
Golga4 A G 9: 118,556,845 K22E probably damaging Het
Hecw2 T C 1: 53,813,222 *1579W probably null Het
Ica1l A G 1: 60,013,818 probably null Het
Ift122 T A 6: 115,890,588 L433Q probably damaging Het
Iqgap1 T C 7: 80,762,567 probably null Het
Klra13-ps T C 6: 130,291,269 noncoding transcript Het
Mndal A T 1: 173,875,664 Y58* probably null Het
Mvb12b G C 2: 33,827,700 P172R possibly damaging Het
Ncapg T C 5: 45,671,212 F102L probably damaging Het
Olfr1447 T A 19: 12,901,268 K171* probably null Het
Olfr235 T C 19: 12,268,824 V198A possibly damaging Het
Pde8a A T 7: 81,328,099 R713S probably damaging Het
Rbks T C 5: 31,624,568 N296S probably benign Het
Sema3c G A 5: 17,694,772 V421I probably benign Het
Tm9sf1 A G 14: 55,638,108 V393A possibly damaging Het
Tubgcp2 G A 7: 139,996,071 P893L possibly damaging Het
Vnn3 G A 10: 23,856,326 R158H probably benign Het
Zfa-ps G T 10: 52,544,936 noncoding transcript Het
Zfp414 T C 17: 33,631,648 probably benign Het
Zfp810 G A 9: 22,278,745 T289I probably damaging Het
Zfp819 G T 7: 43,617,785 R488L probably damaging Het
Zfp942 C T 17: 21,928,304 G448D probably benign Het
Zscan12 A G 13: 21,366,705 K165E possibly damaging Het
Other mutations in Olfr390
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Olfr390 APN 11 73787580 missense probably damaging 1.00
IGL01621:Olfr390 APN 11 73787277 missense probably damaging 0.99
IGL01630:Olfr390 APN 11 73787861 missense probably benign 0.14
IGL01866:Olfr390 APN 11 73787828 missense probably benign 0.28
IGL02577:Olfr390 APN 11 73787046 missense probably damaging 1.00
IGL02617:Olfr390 APN 11 73787734 missense probably benign 0.01
IGL03017:Olfr390 APN 11 73787518 missense probably benign 0.01
IGL03215:Olfr390 APN 11 73787385 missense probably damaging 1.00
IGL03342:Olfr390 APN 11 73787483 missense probably benign 0.03
IGL03098:Olfr390 UTSW 11 73787703 missense probably benign 0.29
R0115:Olfr390 UTSW 11 73787315 missense possibly damaging 0.45
R0217:Olfr390 UTSW 11 73787388 missense possibly damaging 0.90
R1971:Olfr390 UTSW 11 73787790 missense probably damaging 1.00
R2033:Olfr390 UTSW 11 73787438 missense probably benign 0.15
R2058:Olfr390 UTSW 11 73787274 missense probably benign 0.00
R3051:Olfr390 UTSW 11 73787234 missense probably benign 0.01
R3622:Olfr390 UTSW 11 73787741 missense probably benign 0.00
R3913:Olfr390 UTSW 11 73787696 missense probably damaging 1.00
R4656:Olfr390 UTSW 11 73787511 missense probably damaging 1.00
R5120:Olfr390 UTSW 11 73786964 missense probably benign 0.01
R5635:Olfr390 UTSW 11 73787634 missense probably benign 0.26
R6020:Olfr390 UTSW 11 73787552 missense probably benign 0.03
R6151:Olfr390 UTSW 11 73787695 nonsense probably null
R6885:Olfr390 UTSW 11 73787100 missense possibly damaging 0.94
R6984:Olfr390 UTSW 11 73787777 missense possibly damaging 0.91
R7057:Olfr390 UTSW 11 73787148 missense possibly damaging 0.88
R7120:Olfr390 UTSW 11 73787114 missense probably damaging 0.98
R7704:Olfr390 UTSW 11 73787790 missense probably damaging 1.00
R8323:Olfr390 UTSW 11 73786940 start codon destroyed probably damaging 1.00
R9100:Olfr390 UTSW 11 73787861 missense probably benign 0.14
R9258:Olfr390 UTSW 11 73787455 missense probably benign 0.28
R9384:Olfr390 UTSW 11 73786970 missense probably benign
R9421:Olfr390 UTSW 11 73787101 missense probably benign 0.23
R9450:Olfr390 UTSW 11 73787275 missense possibly damaging 0.56
R9698:Olfr390 UTSW 11 73787616 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCAGACTATCATCTCTCAGTTC -3'
(R):5'- TTGGGGCTCATGATACTGGC -3'

Sequencing Primer
(F):5'- AGTTCTTACTCCTGGGCCTG -3'
(R):5'- GGCTCATGATACTGGCATAATG -3'
Posted On 2015-08-18