Incidental Mutation 'R4545:Zscan12'
ID333732
Institutional Source Beutler Lab
Gene Symbol Zscan12
Ensembl Gene ENSMUSG00000036721
Gene Namezinc finger and SCAN domain containing 12
SynonymsZfp96
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4545 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location21362820-21372289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21366705 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 165 (K165E)
Ref Sequence ENSEMBL: ENSMUSP00000153548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053293] [ENSMUST00000099720] [ENSMUST00000225545]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053293
AA Change: K165E

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000058904
Gene: ENSMUSG00000036721
AA Change: K165E

DomainStartEndE-ValueType
SCAN 42 154 2.52e-74 SMART
ZnF_C2H2 269 291 5.5e-3 SMART
ZnF_C2H2 297 319 1.72e-4 SMART
ZnF_C2H2 325 347 1.22e-4 SMART
ZnF_C2H2 353 375 5.5e-3 SMART
ZnF_C2H2 381 403 1.95e-3 SMART
ZnF_C2H2 409 431 1.45e-2 SMART
ZnF_C2H2 455 477 2.43e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000099720
AA Change: K165E

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097308
Gene: ENSMUSG00000036721
AA Change: K165E

DomainStartEndE-ValueType
SCAN 42 154 2.52e-74 SMART
ZnF_C2H2 269 291 5.5e-3 SMART
ZnF_C2H2 297 319 1.72e-4 SMART
ZnF_C2H2 325 347 1.22e-4 SMART
ZnF_C2H2 353 375 5.5e-3 SMART
ZnF_C2H2 381 403 1.95e-3 SMART
ZnF_C2H2 409 431 1.45e-2 SMART
ZnF_C2H2 455 477 2.43e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000225545
AA Change: K165E

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.0649 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Atf7 A G 15: 102,534,327 V449A probably benign Het
Ccr1 G A 9: 123,964,400 A31V probably benign Het
Chrna6 A T 8: 27,406,683 S389T probably benign Het
Clic6 C T 16: 92,492,157 probably benign Het
Cmya5 G A 13: 93,091,918 R2221* probably null Het
Coq8b G T 7: 27,233,505 C13F probably benign Het
Cspg4 T A 9: 56,888,629 L1216Q possibly damaging Het
Decr1 C A 4: 15,930,979 V118F probably damaging Het
Dlec1 A T 9: 119,128,078 I796F probably damaging Het
Dnajc11 T A 4: 151,979,941 D516E probably damaging Het
Dock8 G A 19: 25,188,358 V1869M probably damaging Het
Dst A G 1: 34,188,738 D1982G probably damaging Het
Gm11808 C T 4: 3,973,244 R106H probably benign Het
Gnptab G A 10: 88,414,595 D190N probably benign Het
Golga4 A G 9: 118,556,845 K22E probably damaging Het
Hecw2 T C 1: 53,813,222 *1579W probably null Het
Ica1l A G 1: 60,013,818 probably null Het
Ift122 T A 6: 115,890,588 L433Q probably damaging Het
Iqgap1 T C 7: 80,762,567 probably null Het
Klra13-ps T C 6: 130,291,269 noncoding transcript Het
Mndal A T 1: 173,875,664 Y58* probably null Het
Mvb12b G C 2: 33,827,700 P172R possibly damaging Het
Ncapg T C 5: 45,671,212 F102L probably damaging Het
Olfr1447 T A 19: 12,901,268 K171* probably null Het
Olfr235 T C 19: 12,268,824 V198A possibly damaging Het
Olfr390 T C 11: 73,787,166 V76A probably damaging Het
Pde8a A T 7: 81,328,099 R713S probably damaging Het
Rbks T C 5: 31,624,568 N296S probably benign Het
Sema3c G A 5: 17,694,772 V421I probably benign Het
Tm9sf1 A G 14: 55,638,108 V393A possibly damaging Het
Tubgcp2 G A 7: 139,996,071 P893L possibly damaging Het
Vnn3 G A 10: 23,856,326 R158H probably benign Het
Zfa-ps G T 10: 52,544,936 noncoding transcript Het
Zfp414 T C 17: 33,631,648 probably benign Het
Zfp810 G A 9: 22,278,745 T289I probably damaging Het
Zfp819 G T 7: 43,617,785 R488L probably damaging Het
Zfp942 C T 17: 21,928,304 G448D probably benign Het
Other mutations in Zscan12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02864:Zscan12 APN 13 21368560 missense probably benign 0.02
PIT4480001:Zscan12 UTSW 13 21368574 missense possibly damaging 0.72
R0122:Zscan12 UTSW 13 21368969 missense probably damaging 1.00
R1605:Zscan12 UTSW 13 21366643 missense probably benign 0.00
R1639:Zscan12 UTSW 13 21368986 missense probably damaging 0.99
R2182:Zscan12 UTSW 13 21368791 missense probably benign 0.33
R2931:Zscan12 UTSW 13 21364017 missense possibly damaging 0.92
R3930:Zscan12 UTSW 13 21368630 missense probably benign 0.18
R4368:Zscan12 UTSW 13 21369383 missense probably benign 0.00
R4461:Zscan12 UTSW 13 21366619 missense possibly damaging 0.83
R5353:Zscan12 UTSW 13 21364008 missense possibly damaging 0.51
R6580:Zscan12 UTSW 13 21369158 missense probably damaging 0.99
R6734:Zscan12 UTSW 13 21368796 nonsense probably null
R7462:Zscan12 UTSW 13 21369287 missense possibly damaging 0.94
R7505:Zscan12 UTSW 13 21368586 missense possibly damaging 0.72
R7822:Zscan12 UTSW 13 21369204 missense probably damaging 0.99
R8028:Zscan12 UTSW 13 21368852 missense probably benign 0.01
R8056:Zscan12 UTSW 13 21369322 missense probably benign 0.29
R8161:Zscan12 UTSW 13 21363727 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGTTCCCTGGATTGAGTGAC -3'
(R):5'- TGCATGTCAACACGTGAGC -3'

Sequencing Primer
(F):5'- CGATCGAGACATGCTGATTGC -3'
(R):5'- CAACACGTGAGCATCAGATTTCTGG -3'
Posted On2015-08-18