Incidental Mutation 'R4545:Tm9sf1'
ID333734
Institutional Source Beutler Lab
Gene Symbol Tm9sf1
Ensembl Gene ENSMUSG00000002320
Gene Nametransmembrane 9 superfamily member 1
Synonyms1200014D02Rik, MP70
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R4545 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location55635965-55643806 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55638108 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 393 (V393A)
Ref Sequence ENSEMBL: ENSMUSP00000113782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002391] [ENSMUST00000047131] [ENSMUST00000120041] [ENSMUST00000121791] [ENSMUST00000121937] [ENSMUST00000122358] [ENSMUST00000125133] [ENSMUST00000132338] [ENSMUST00000133707] [ENSMUST00000135221] [ENSMUST00000149726] [ENSMUST00000138085] [ENSMUST00000148351]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002391
AA Change: V393A

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000002391
Gene: ENSMUSG00000002320
AA Change: V393A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 564 1.3e-187 PFAM
transmembrane domain 569 591 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047131
SMART Domains Protein: ENSMUSP00000036555
Gene: ENSMUSG00000002319

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Blast:IBN_N 101 170 4e-20 BLAST
Blast:IBN_N 224 293 4e-31 BLAST
low complexity region 307 321 N/A INTRINSIC
Pfam:HEAT 395 425 7.7e-7 PFAM
Blast:ARM 465 499 8e-13 BLAST
low complexity region 500 511 N/A INTRINSIC
low complexity region 636 660 N/A INTRINSIC
low complexity region 733 743 N/A INTRINSIC
low complexity region 811 830 N/A INTRINSIC
low complexity region 851 864 N/A INTRINSIC
Pfam:HEAT 901 931 1.9e-5 PFAM
Pfam:HEAT_EZ 914 969 2.3e-9 PFAM
low complexity region 1043 1053 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120041
AA Change: V393A

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112893
Gene: ENSMUSG00000002320
AA Change: V393A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 564 1.3e-187 PFAM
transmembrane domain 569 591 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121791
AA Change: V393A

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112764
Gene: ENSMUSG00000002320
AA Change: V393A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 564 1.3e-187 PFAM
transmembrane domain 569 591 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121937
AA Change: V393A

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113143
Gene: ENSMUSG00000002320
AA Change: V393A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 547 9e-169 PFAM
transmembrane domain 550 572 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000122358
AA Change: V393A

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113782
Gene: ENSMUSG00000002320
AA Change: V393A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 58 563 2.3e-164 PFAM
transmembrane domain 569 591 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130167
Predicted Effect possibly damaging
Transcript: ENSMUST00000132338
AA Change: V393A

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118427
Gene: ENSMUSG00000002320
AA Change: V393A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 477 9.2e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133707
SMART Domains Protein: ENSMUSP00000123471
Gene: ENSMUSG00000002320

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 118 1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135221
SMART Domains Protein: ENSMUSP00000123692
Gene: ENSMUSG00000002319

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Blast:IBN_N 101 170 3e-20 BLAST
Blast:IBN_N 224 293 2e-31 BLAST
low complexity region 307 321 N/A INTRINSIC
Pfam:HEAT 395 425 7.4e-7 PFAM
Blast:ARM 465 499 7e-13 BLAST
low complexity region 500 511 N/A INTRINSIC
low complexity region 636 660 N/A INTRINSIC
low complexity region 733 743 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146588
Predicted Effect probably benign
Transcript: ENSMUST00000156420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148942
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139313
Predicted Effect probably benign
Transcript: ENSMUST00000149726
SMART Domains Protein: ENSMUSP00000115403
Gene: ENSMUSG00000002320

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 390 1.7e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138085
SMART Domains Protein: ENSMUSP00000119435
Gene: ENSMUSG00000002320

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 172 2.9e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148351
SMART Domains Protein: ENSMUSP00000117543
Gene: ENSMUSG00000002319

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Meta Mutation Damage Score 0.5292 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Atf7 A G 15: 102,534,327 V449A probably benign Het
Ccr1 G A 9: 123,964,400 A31V probably benign Het
Chrna6 A T 8: 27,406,683 S389T probably benign Het
Clic6 C T 16: 92,492,157 probably benign Het
Cmya5 G A 13: 93,091,918 R2221* probably null Het
Coq8b G T 7: 27,233,505 C13F probably benign Het
Cspg4 T A 9: 56,888,629 L1216Q possibly damaging Het
Decr1 C A 4: 15,930,979 V118F probably damaging Het
Dlec1 A T 9: 119,128,078 I796F probably damaging Het
Dnajc11 T A 4: 151,979,941 D516E probably damaging Het
Dock8 G A 19: 25,188,358 V1869M probably damaging Het
Dst A G 1: 34,188,738 D1982G probably damaging Het
Gm11808 C T 4: 3,973,244 R106H probably benign Het
Gnptab G A 10: 88,414,595 D190N probably benign Het
Golga4 A G 9: 118,556,845 K22E probably damaging Het
Hecw2 T C 1: 53,813,222 *1579W probably null Het
Ica1l A G 1: 60,013,818 probably null Het
Ift122 T A 6: 115,890,588 L433Q probably damaging Het
Iqgap1 T C 7: 80,762,567 probably null Het
Klra13-ps T C 6: 130,291,269 noncoding transcript Het
Mndal A T 1: 173,875,664 Y58* probably null Het
Mvb12b G C 2: 33,827,700 P172R possibly damaging Het
Ncapg T C 5: 45,671,212 F102L probably damaging Het
Olfr1447 T A 19: 12,901,268 K171* probably null Het
Olfr235 T C 19: 12,268,824 V198A possibly damaging Het
Olfr390 T C 11: 73,787,166 V76A probably damaging Het
Pde8a A T 7: 81,328,099 R713S probably damaging Het
Rbks T C 5: 31,624,568 N296S probably benign Het
Sema3c G A 5: 17,694,772 V421I probably benign Het
Tubgcp2 G A 7: 139,996,071 P893L possibly damaging Het
Vnn3 G A 10: 23,856,326 R158H probably benign Het
Zfa-ps G T 10: 52,544,936 noncoding transcript Het
Zfp414 T C 17: 33,631,648 probably benign Het
Zfp810 G A 9: 22,278,745 T289I probably damaging Het
Zfp819 G T 7: 43,617,785 R488L probably damaging Het
Zfp942 C T 17: 21,928,304 G448D probably benign Het
Zscan12 A G 13: 21,366,705 K165E possibly damaging Het
Other mutations in Tm9sf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Tm9sf1 APN 14 55642727 missense probably damaging 1.00
IGL01102:Tm9sf1 APN 14 55642767 missense probably damaging 1.00
IGL02263:Tm9sf1 APN 14 55642935 missense possibly damaging 0.95
R0242:Tm9sf1 UTSW 14 55637935 missense possibly damaging 0.90
R0242:Tm9sf1 UTSW 14 55637935 missense possibly damaging 0.90
R0469:Tm9sf1 UTSW 14 55641429 missense possibly damaging 0.87
R0928:Tm9sf1 UTSW 14 55636457 missense probably damaging 1.00
R0973:Tm9sf1 UTSW 14 55642935 missense possibly damaging 0.95
R0973:Tm9sf1 UTSW 14 55642935 missense possibly damaging 0.95
R0974:Tm9sf1 UTSW 14 55642935 missense possibly damaging 0.95
R1441:Tm9sf1 UTSW 14 55636325 missense probably damaging 1.00
R1644:Tm9sf1 UTSW 14 55641300 missense probably benign 0.03
R1873:Tm9sf1 UTSW 14 55636223 missense probably damaging 1.00
R2176:Tm9sf1 UTSW 14 55641409 missense possibly damaging 0.89
R2973:Tm9sf1 UTSW 14 55641114 missense probably benign 0.01
R4284:Tm9sf1 UTSW 14 55641323 missense probably damaging 1.00
R4633:Tm9sf1 UTSW 14 55641203 missense probably damaging 1.00
R4816:Tm9sf1 UTSW 14 55641149 missense possibly damaging 0.89
R4943:Tm9sf1 UTSW 14 55641168 missense probably damaging 0.99
R5270:Tm9sf1 UTSW 14 55636481 missense probably damaging 1.00
R5384:Tm9sf1 UTSW 14 55642844 missense possibly damaging 0.80
R5385:Tm9sf1 UTSW 14 55642844 missense possibly damaging 0.80
R5386:Tm9sf1 UTSW 14 55642844 missense possibly damaging 0.80
R5561:Tm9sf1 UTSW 14 55638097 missense probably damaging 1.00
R6246:Tm9sf1 UTSW 14 55636370 missense probably damaging 1.00
R6247:Tm9sf1 UTSW 14 55636370 missense probably damaging 1.00
R6248:Tm9sf1 UTSW 14 55636370 missense probably damaging 1.00
R7319:Tm9sf1 UTSW 14 55637975 unclassified probably benign
R7659:Tm9sf1 UTSW 14 55636335 missense probably damaging 1.00
R7974:Tm9sf1 UTSW 14 55636449 missense probably damaging 1.00
X0025:Tm9sf1 UTSW 14 55642836 missense probably benign 0.43
X0026:Tm9sf1 UTSW 14 55642937 start codon destroyed probably null 0.92
Predicted Primers PCR Primer
(F):5'- CCACCAACAGTCATGTGGATG -3'
(R):5'- GGTCAAAGTGGATTCAATCAGC -3'

Sequencing Primer
(F):5'- CATGTGGATGACAGTAGACTTGTACC -3'
(R):5'- CAAAGTGGATTCAATCAGCTCTGGC -3'
Posted On2015-08-18