Incidental Mutation 'R4545:Clic6'
ID333736
Institutional Source Beutler Lab
Gene Symbol Clic6
Ensembl Gene ENSMUSG00000022949
Gene Namechloride intracellular channel 6
SynonymsCLIC1L, 5730466J16Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R4545 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location92485736-92541243 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 92492157 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162181]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160494
SMART Domains Protein: ENSMUSP00000123968
Gene: ENSMUSG00000051297

DomainStartEndE-ValueType
low complexity region 4 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162181
SMART Domains Protein: ENSMUSP00000124498
Gene: ENSMUSG00000022949

DomainStartEndE-ValueType
Pfam:GST_N_3 34 100 2.8e-10 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chloride intracellular channel family of proteins. The gene is part of a large triplicated region found on chromosomes 1, 6, and 21. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Atf7 A G 15: 102,534,327 V449A probably benign Het
Ccr1 G A 9: 123,964,400 A31V probably benign Het
Chrna6 A T 8: 27,406,683 S389T probably benign Het
Cmya5 G A 13: 93,091,918 R2221* probably null Het
Coq8b G T 7: 27,233,505 C13F probably benign Het
Cspg4 T A 9: 56,888,629 L1216Q possibly damaging Het
Decr1 C A 4: 15,930,979 V118F probably damaging Het
Dlec1 A T 9: 119,128,078 I796F probably damaging Het
Dnajc11 T A 4: 151,979,941 D516E probably damaging Het
Dock8 G A 19: 25,188,358 V1869M probably damaging Het
Dst A G 1: 34,188,738 D1982G probably damaging Het
Gm11808 C T 4: 3,973,244 R106H probably benign Het
Gnptab G A 10: 88,414,595 D190N probably benign Het
Golga4 A G 9: 118,556,845 K22E probably damaging Het
Hecw2 T C 1: 53,813,222 *1579W probably null Het
Ica1l A G 1: 60,013,818 probably null Het
Ift122 T A 6: 115,890,588 L433Q probably damaging Het
Iqgap1 T C 7: 80,762,567 probably null Het
Klra13-ps T C 6: 130,291,269 noncoding transcript Het
Mndal A T 1: 173,875,664 Y58* probably null Het
Mvb12b G C 2: 33,827,700 P172R possibly damaging Het
Ncapg T C 5: 45,671,212 F102L probably damaging Het
Olfr1447 T A 19: 12,901,268 K171* probably null Het
Olfr235 T C 19: 12,268,824 V198A possibly damaging Het
Olfr390 T C 11: 73,787,166 V76A probably damaging Het
Pde8a A T 7: 81,328,099 R713S probably damaging Het
Rbks T C 5: 31,624,568 N296S probably benign Het
Sema3c G A 5: 17,694,772 V421I probably benign Het
Tm9sf1 A G 14: 55,638,108 V393A possibly damaging Het
Tubgcp2 G A 7: 139,996,071 P893L possibly damaging Het
Vnn3 G A 10: 23,856,326 R158H probably benign Het
Zfa-ps G T 10: 52,544,936 noncoding transcript Het
Zfp414 T C 17: 33,631,648 probably benign Het
Zfp810 G A 9: 22,278,745 T289I probably damaging Het
Zfp819 G T 7: 43,617,785 R488L probably damaging Het
Zfp942 C T 17: 21,928,304 G448D probably benign Het
Zscan12 A G 13: 21,366,705 K165E possibly damaging Het
Other mutations in Clic6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Clic6 APN 16 92499308 missense probably damaging 0.99
IGL02104:Clic6 APN 16 92498479 missense possibly damaging 0.72
IGL02387:Clic6 APN 16 92529919 missense probably damaging 1.00
IGL02437:Clic6 APN 16 92530929 missense probably damaging 1.00
IGL02617:Clic6 APN 16 92499318 missense probably benign 0.00
unsweetened UTSW 16 92530809 missense possibly damaging 0.79
R1544:Clic6 UTSW 16 92492073 intron probably benign
R1677:Clic6 UTSW 16 92528084 missense probably damaging 1.00
R2149:Clic6 UTSW 16 92499207 missense probably benign 0.00
R3965:Clic6 UTSW 16 92498844 missense probably benign 0.00
R4171:Clic6 UTSW 16 92497061 intron probably benign
R4637:Clic6 UTSW 16 92497061 intron probably benign
R4649:Clic6 UTSW 16 92530939 critical splice donor site probably null
R5159:Clic6 UTSW 16 92528066 missense probably benign 0.13
R5249:Clic6 UTSW 16 92539451 missense probably damaging 1.00
R5486:Clic6 UTSW 16 92529852 splice site probably null
R5582:Clic6 UTSW 16 92499454 missense possibly damaging 0.93
R6140:Clic6 UTSW 16 92539492 missense probably damaging 1.00
R6234:Clic6 UTSW 16 92499222 missense probably benign
R6379:Clic6 UTSW 16 92539535 missense probably damaging 1.00
R6593:Clic6 UTSW 16 92528117 missense possibly damaging 0.82
R7890:Clic6 UTSW 16 92499387 missense probably benign 0.41
RF012:Clic6 UTSW 16 92530809 missense possibly damaging 0.79
X0058:Clic6 UTSW 16 92498707 missense probably benign
Z1176:Clic6 UTSW 16 92498895 missense probably benign 0.26
Z1177:Clic6 UTSW 16 92499139 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CAAAATATTCACAGGTGGAGGC -3'
(R):5'- GGTGATCTTGGACTCCTGTC -3'

Sequencing Primer
(F):5'- AGGCAGAAGGTTTACATCGAGTTTC -3'
(R):5'- GTGATCTTGGACTCCTGTCAAATCAG -3'
Posted On2015-08-18