Mutagenetix > Incidental Mutation

Incidental Mutation 'R4545:Clic6'

333736

Institutional Source

Beutler Lab

Gene Symbol

Clic6

Ensembl Gene

ENSMUSG00000022949

Gene Name

chloride intracellular channel 6

Synonyms

CLIC1L, 5730466J16Rik

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.150) question?

Stock #

R4545 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

92485736-92541243 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

C to T at 92492157 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000124498 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000162181]

AlphaFold

Q8BHB9

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160494

SMART Domains

Protein: ENSMUSP00000123968
Gene: ENSMUSG00000051297

Domain	Start	End	E-Value	Type
low complexity region	4	22	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000162181

SMART Domains

Protein: ENSMUSP00000124498
Gene: ENSMUSG00000022949

Domain	Start	End	E-Value	Type
Pfam:GST_N_3	34	100	2.8e-10	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

98% (41/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chloride intracellular channel family of proteins. The gene is part of a large triplicated region found on chromosomes 1, 6, and 21. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akr1c20	A	C	13: 4,507,844	V201G	probably damaging	Het
Atf7	A	G	15: 102,534,327	V449A	probably benign	Het
Ccr1	G	A	9: 123,964,400	A31V	probably benign	Het
Chrna6	A	T	8: 27,406,683	S389T	probably benign	Het
Cmya5	G	A	13: 93,091,918	R2221*	probably null	Het
Coq8b	G	T	7: 27,233,505	C13F	probably benign	Het
Cspg4	T	A	9: 56,888,629	L1216Q	possibly damaging	Het
Decr1	C	A	4: 15,930,979	V118F	probably damaging	Het
Dlec1	A	T	9: 119,128,078	I796F	probably damaging	Het
Dnajc11	T	A	4: 151,979,941	D516E	probably damaging	Het
Dock8	G	A	19: 25,188,358	V1869M	probably damaging	Het
Dst	A	G	1: 34,188,738	D1982G	probably damaging	Het
Gm11808	C	T	4: 3,973,244	R106H	probably benign	Het
Gnptab	G	A	10: 88,414,595	D190N	probably benign	Het
Golga4	A	G	9: 118,556,845	K22E	probably damaging	Het
Hecw2	T	C	1: 53,813,222	*1579W	probably null	Het
Ica1l	A	G	1: 60,013,818		probably null	Het
Ift122	T	A	6: 115,890,588	L433Q	probably damaging	Het
Iqgap1	T	C	7: 80,762,567		probably null	Het
Klra13-ps	T	C	6: 130,291,269		noncoding transcript	Het
Mndal	A	T	1: 173,875,664	Y58*	probably null	Het
Mvb12b	G	C	2: 33,827,700	P172R	possibly damaging	Het
Ncapg	T	C	5: 45,671,212	F102L	probably damaging	Het
Olfr1447	T	A	19: 12,901,268	K171*	probably null	Het
Olfr235	T	C	19: 12,268,824	V198A	possibly damaging	Het
Olfr390	T	C	11: 73,787,166	V76A	probably damaging	Het
Pde8a	A	T	7: 81,328,099	R713S	probably damaging	Het
Rbks	T	C	5: 31,624,568	N296S	probably benign	Het
Sema3c	G	A	5: 17,694,772	V421I	probably benign	Het
Tm9sf1	A	G	14: 55,638,108	V393A	possibly damaging	Het
Tubgcp2	G	A	7: 139,996,071	P893L	possibly damaging	Het
Vnn3	G	A	10: 23,856,326	R158H	probably benign	Het
Zfa-ps	G	T	10: 52,544,936		noncoding transcript	Het
Zfp414	T	C	17: 33,631,648		probably benign	Het
Zfp810	G	A	9: 22,278,745	T289I	probably damaging	Het
Zfp819	G	T	7: 43,617,785	R488L	probably damaging	Het
Zfp942	C	T	17: 21,928,304	G448D	probably benign	Het
Zscan12	A	G	13: 21,366,705	K165E	possibly damaging	Het

Other mutations in Clic6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Clic6	APN	16	92499308	missense	probably damaging	0.99
IGL02104:Clic6	APN	16	92498479	missense	possibly damaging	0.72
IGL02387:Clic6	APN	16	92529919	missense	probably damaging	1.00
IGL02437:Clic6	APN	16	92530929	missense	probably damaging	1.00
IGL02617:Clic6	APN	16	92499318	missense	probably benign	0.00
unsweetened	UTSW	16	92530809	missense	possibly damaging	0.79
R1544:Clic6	UTSW	16	92492073	intron	probably benign
R1677:Clic6	UTSW	16	92528084	missense	probably damaging	1.00
R2149:Clic6	UTSW	16	92499207	missense	probably benign	0.00
R3965:Clic6	UTSW	16	92498844	missense	probably benign	0.00
R4171:Clic6	UTSW	16	92497061	intron	probably benign
R4637:Clic6	UTSW	16	92497061	intron	probably benign
R4649:Clic6	UTSW	16	92530939	critical splice donor site	probably null
R5159:Clic6	UTSW	16	92528066	missense	probably benign	0.13
R5249:Clic6	UTSW	16	92539451	missense	probably damaging	1.00
R5486:Clic6	UTSW	16	92529852	splice site	probably null
R5582:Clic6	UTSW	16	92499454	missense	possibly damaging	0.93
R6140:Clic6	UTSW	16	92539492	missense	probably damaging	1.00
R6234:Clic6	UTSW	16	92499222	missense	probably benign
R6379:Clic6	UTSW	16	92539535	missense	probably damaging	1.00
R6593:Clic6	UTSW	16	92528117	missense	possibly damaging	0.82
R7890:Clic6	UTSW	16	92499387	missense	probably benign	0.41
R8794:Clic6	UTSW	16	92528099	missense	possibly damaging	0.91
R8937:Clic6	UTSW	16	92499357	missense	probably damaging	0.98
R9450:Clic6	UTSW	16	92530756	missense	possibly damaging	0.95
R9502:Clic6	UTSW	16	92498700	missense	probably damaging	1.00
RF012:Clic6	UTSW	16	92530809	missense	possibly damaging	0.79
X0058:Clic6	UTSW	16	92498707	missense	probably benign
Z1176:Clic6	UTSW	16	92498895	missense	probably benign	0.26
Z1177:Clic6	UTSW	16	92499139	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- CAAAATATTCACAGGTGGAGGC -3'
(R):5'- GGTGATCTTGGACTCCTGTC -3'

Sequencing Primer
(F):5'- AGGCAGAAGGTTTACATCGAGTTTC -3'
(R):5'- GTGATCTTGGACTCCTGTCAAATCAG -3'

Posted On

2015-08-18