Incidental Mutation 'R4545:Zfp942'
ID333737
Institutional Source Beutler Lab
Gene Symbol Zfp942
Ensembl Gene ENSMUSG00000071267
Gene Namezinc finger protein 942
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R4545 (G1)
Quality Score203
Status Validated
Chromosome17
Chromosomal Location21926960-21962464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 21928304 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 448 (G448D)
Ref Sequence ENSEMBL: ENSMUSP00000089494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074295] [ENSMUST00000091879]
Predicted Effect probably benign
Transcript: ENSMUST00000074295
AA Change: G448D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000073907
Gene: ENSMUSG00000071267
AA Change: G448D

DomainStartEndE-ValueType
KRAB 13 69 6.55e-19 SMART
ZnF_C2H2 183 205 1.16e-1 SMART
ZnF_C2H2 211 233 8.22e-2 SMART
ZnF_C2H2 239 261 5.14e-3 SMART
ZnF_C2H2 267 289 8.02e-5 SMART
ZnF_C2H2 295 317 2.32e-1 SMART
ZnF_C2H2 323 345 1.6e-4 SMART
ZnF_C2H2 351 373 8.94e-3 SMART
ZnF_C2H2 379 401 1.95e-3 SMART
ZnF_C2H2 407 429 2.24e-3 SMART
ZnF_C2H2 435 457 7.49e-5 SMART
ZnF_C2H2 463 485 2.99e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091879
AA Change: G448D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000089494
Gene: ENSMUSG00000071267
AA Change: G448D

DomainStartEndE-ValueType
KRAB 13 69 6.55e-19 SMART
ZnF_C2H2 183 205 1.16e-1 SMART
ZnF_C2H2 211 233 8.22e-2 SMART
ZnF_C2H2 239 261 5.14e-3 SMART
ZnF_C2H2 267 289 8.02e-5 SMART
ZnF_C2H2 295 317 2.32e-1 SMART
ZnF_C2H2 323 345 1.6e-4 SMART
ZnF_C2H2 351 373 8.94e-3 SMART
ZnF_C2H2 379 401 1.95e-3 SMART
ZnF_C2H2 407 429 2.24e-3 SMART
ZnF_C2H2 435 457 7.49e-5 SMART
ZnF_C2H2 463 485 2.99e-4 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Atf7 A G 15: 102,534,327 V449A probably benign Het
Ccr1 G A 9: 123,964,400 A31V probably benign Het
Chrna6 A T 8: 27,406,683 S389T probably benign Het
Clic6 C T 16: 92,492,157 probably benign Het
Cmya5 G A 13: 93,091,918 R2221* probably null Het
Coq8b G T 7: 27,233,505 C13F probably benign Het
Cspg4 T A 9: 56,888,629 L1216Q possibly damaging Het
Decr1 C A 4: 15,930,979 V118F probably damaging Het
Dlec1 A T 9: 119,128,078 I796F probably damaging Het
Dnajc11 T A 4: 151,979,941 D516E probably damaging Het
Dock8 G A 19: 25,188,358 V1869M probably damaging Het
Dst A G 1: 34,188,738 D1982G probably damaging Het
Gm11808 C T 4: 3,973,244 R106H probably benign Het
Gnptab G A 10: 88,414,595 D190N probably benign Het
Golga4 A G 9: 118,556,845 K22E probably damaging Het
Hecw2 T C 1: 53,813,222 *1579W probably null Het
Ica1l A G 1: 60,013,818 probably null Het
Ift122 T A 6: 115,890,588 L433Q probably damaging Het
Iqgap1 T C 7: 80,762,567 probably null Het
Klra13-ps T C 6: 130,291,269 noncoding transcript Het
Mndal A T 1: 173,875,664 Y58* probably null Het
Mvb12b G C 2: 33,827,700 P172R possibly damaging Het
Ncapg T C 5: 45,671,212 F102L probably damaging Het
Olfr1447 T A 19: 12,901,268 K171* probably null Het
Olfr235 T C 19: 12,268,824 V198A possibly damaging Het
Olfr390 T C 11: 73,787,166 V76A probably damaging Het
Pde8a A T 7: 81,328,099 R713S probably damaging Het
Rbks T C 5: 31,624,568 N296S probably benign Het
Sema3c G A 5: 17,694,772 V421I probably benign Het
Tm9sf1 A G 14: 55,638,108 V393A possibly damaging Het
Tubgcp2 G A 7: 139,996,071 P893L possibly damaging Het
Vnn3 G A 10: 23,856,326 R158H probably benign Het
Zfa-ps G T 10: 52,544,936 noncoding transcript Het
Zfp414 T C 17: 33,631,648 probably benign Het
Zfp810 G A 9: 22,278,745 T289I probably damaging Het
Zfp819 G T 7: 43,617,785 R488L probably damaging Het
Zscan12 A G 13: 21,366,705 K165E possibly damaging Het
Other mutations in Zfp942
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Zfp942 APN 17 21929061 missense probably benign
IGL00586:Zfp942 APN 17 21928624 missense probably damaging 1.00
IGL02973:Zfp942 APN 17 21932991 critical splice donor site probably null
IGL03212:Zfp942 APN 17 21929464 nonsense probably null
IGL03382:Zfp942 APN 17 21929102 missense probably benign 0.04
R0008:Zfp942 UTSW 17 21928338 missense probably damaging 1.00
R0113:Zfp942 UTSW 17 21929085 missense probably benign 0.18
R0244:Zfp942 UTSW 17 21928572 missense probably benign 0.02
R0369:Zfp942 UTSW 17 21929036 missense probably benign 0.41
R1664:Zfp942 UTSW 17 21928439 missense possibly damaging 0.83
R1824:Zfp942 UTSW 17 21928541 missense probably damaging 1.00
R4785:Zfp942 UTSW 17 21929419 missense probably damaging 1.00
R5493:Zfp942 UTSW 17 21933004 missense probably null 0.66
R6568:Zfp942 UTSW 17 21929062 missense probably benign 0.14
R6733:Zfp942 UTSW 17 21928752 nonsense probably null
R7650:Zfp942 UTSW 17 21928837 missense probably benign 0.07
R7935:Zfp942 UTSW 17 21929227 nonsense probably null
R8065:Zfp942 UTSW 17 21930410 missense probably damaging 0.96
R8067:Zfp942 UTSW 17 21930410 missense probably damaging 0.96
R8237:Zfp942 UTSW 17 21928245 missense possibly damaging 0.92
X0025:Zfp942 UTSW 17 21929307 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAACACATTTGCCACATTCACTG -3'
(R):5'- ACAAATGCTTTACCCGAAAATGTAA -3'

Sequencing Primer
(F):5'- GCCACATTCACTGCATTTATAAGGC -3'
(R):5'- CCACAAAGGCGGTCTTA -3'
Posted On2015-08-18