Incidental Mutation 'R4545:Olfr235'
ID333739
Institutional Source Beutler Lab
Gene Symbol Olfr235
Ensembl Gene ENSMUSG00000060049
Gene Nameolfactory receptor 235
SynonymsMOR214-3, GA_x6K02T03CT6-1-477, Olfr245, GA_x6K02T2LL2P-1028-792, Olfr232, GA_x6K02T057QT-4025-4642, MOR214-3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R4545 (G1)
Quality Score165
Status Not validated
Chromosome19
Chromosomal Location12261032-12270387 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12268824 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 198 (V198A)
Ref Sequence ENSEMBL: ENSMUSP00000150313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073507] [ENSMUST00000207969] [ENSMUST00000214551] [ENSMUST00000214613] [ENSMUST00000214638] [ENSMUST00000215407]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073507
AA Change: V198A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000073203
Gene: ENSMUSG00000060049
AA Change: V198A

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 3.8e-56 PFAM
Pfam:7tm_1 42 309 1.2e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207842
AA Change: V198A
Predicted Effect possibly damaging
Transcript: ENSMUST00000207969
AA Change: V198A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214551
AA Change: V198A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214613
AA Change: V198A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214638
AA Change: V198A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215407
AA Change: V198A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Atf7 A G 15: 102,534,327 V449A probably benign Het
Ccr1 G A 9: 123,964,400 A31V probably benign Het
Chrna6 A T 8: 27,406,683 S389T probably benign Het
Clic6 C T 16: 92,492,157 probably benign Het
Cmya5 G A 13: 93,091,918 R2221* probably null Het
Coq8b G T 7: 27,233,505 C13F probably benign Het
Cspg4 T A 9: 56,888,629 L1216Q possibly damaging Het
Decr1 C A 4: 15,930,979 V118F probably damaging Het
Dlec1 A T 9: 119,128,078 I796F probably damaging Het
Dnajc11 T A 4: 151,979,941 D516E probably damaging Het
Dock8 G A 19: 25,188,358 V1869M probably damaging Het
Dst A G 1: 34,188,738 D1982G probably damaging Het
Gm11808 C T 4: 3,973,244 R106H probably benign Het
Gnptab G A 10: 88,414,595 D190N probably benign Het
Golga4 A G 9: 118,556,845 K22E probably damaging Het
Hecw2 T C 1: 53,813,222 *1579W probably null Het
Ica1l A G 1: 60,013,818 probably null Het
Ift122 T A 6: 115,890,588 L433Q probably damaging Het
Iqgap1 T C 7: 80,762,567 probably null Het
Klra13-ps T C 6: 130,291,269 noncoding transcript Het
Mndal A T 1: 173,875,664 Y58* probably null Het
Mvb12b G C 2: 33,827,700 P172R possibly damaging Het
Ncapg T C 5: 45,671,212 F102L probably damaging Het
Olfr1447 T A 19: 12,901,268 K171* probably null Het
Olfr390 T C 11: 73,787,166 V76A probably damaging Het
Pde8a A T 7: 81,328,099 R713S probably damaging Het
Rbks T C 5: 31,624,568 N296S probably benign Het
Sema3c G A 5: 17,694,772 V421I probably benign Het
Tm9sf1 A G 14: 55,638,108 V393A possibly damaging Het
Tubgcp2 G A 7: 139,996,071 P893L possibly damaging Het
Vnn3 G A 10: 23,856,326 R158H probably benign Het
Zfa-ps G T 10: 52,544,936 noncoding transcript Het
Zfp414 T C 17: 33,631,648 probably benign Het
Zfp810 G A 9: 22,278,745 T289I probably damaging Het
Zfp819 G T 7: 43,617,785 R488L probably damaging Het
Zfp942 C T 17: 21,928,304 G448D probably benign Het
Zscan12 A G 13: 21,366,705 K165E possibly damaging Het
Other mutations in Olfr235
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02116:Olfr235 APN 19 12269010 missense probably damaging 1.00
IGL03397:Olfr235 APN 19 12268502 missense probably benign 0.03
R1239:Olfr235 UTSW 19 12268976 missense probably damaging 1.00
R1416:Olfr235 UTSW 19 12268894 missense probably benign 0.09
R1441:Olfr235 UTSW 19 12268386 nonsense probably null
R1694:Olfr235 UTSW 19 12268917 missense probably damaging 1.00
R1727:Olfr235 UTSW 19 12269001 missense possibly damaging 0.70
R2422:Olfr235 UTSW 19 12268919 missense probably damaging 0.99
R3439:Olfr235 UTSW 19 12268395 missense possibly damaging 0.56
R4605:Olfr235 UTSW 19 12269168 makesense probably null
R5147:Olfr235 UTSW 19 12268904 missense probably damaging 1.00
R5382:Olfr235 UTSW 19 12268409 missense possibly damaging 0.62
R5717:Olfr235 UTSW 19 12269156 missense probably benign 0.13
R6455:Olfr235 UTSW 19 12268706 missense probably damaging 0.97
R6880:Olfr235 UTSW 19 12268610 missense probably benign 0.22
R7311:Olfr235 UTSW 19 12268704 missense probably benign 0.29
R7384:Olfr235 UTSW 19 12269076 missense possibly damaging 0.80
R8138:Olfr235 UTSW 19 12269072 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- ACACTATGTGCTCAGATGGTGATG -3'
(R):5'- TGTCAAAACTAGAGGAGCCACC -3'

Sequencing Primer
(F):5'- CTCAGATGGTGATGGGAAGCTACAC -3'
(R):5'- CTAGAGGAGCCACCAGAGCTG -3'
Posted On2015-08-18