Mutagenetix > Incidental Mutations

Incidental Mutation 'R4545:Olfr235'

333739

Institutional Source

Beutler Lab

Gene Symbol

Olfr235

Ensembl Gene

ENSMUSG00000060049

Gene Name

olfactory receptor 235

Synonyms

MOR214-3, GA_x6K02T03CT6-1-477, Olfr245, GA_x6K02T2LL2P-1028-792, Olfr232, GA_x6K02T057QT-4025-4642, MOR214-3

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.054) question?

Stock #

R4545 (G1)

Quality Score

165

Status

Not validated

Chromosome

Chromosomal Location

12261032-12270387 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 12268824 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 198 (V198A)

Ref Sequence

ENSEMBL: ENSMUSP00000150313 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073507] [ENSMUST00000207969] [ENSMUST00000214551] [ENSMUST00000214613] [ENSMUST00000214638] [ENSMUST00000215407]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000073507
AA Change: V198A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000073203
Gene: ENSMUSG00000060049
AA Change: V198A

Domain	Start	End	E-Value	Type
Pfam:7tm_4	32	309	3.8e-56	PFAM
Pfam:7tm_1	42	309	1.2e-17	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207842
AA Change: V198A

Predicted Effect

possibly damaging
Transcript: ENSMUST00000207969
AA Change: V198A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000214551
AA Change: V198A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000214613
AA Change: V198A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000214638
AA Change: V198A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000215407
AA Change: V198A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

98% (41/42)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akr1c20	A	C	13: 4,507,844	V201G	probably damaging	Het
Atf7	A	G	15: 102,534,327	V449A	probably benign	Het
Ccr1	G	A	9: 123,964,400	A31V	probably benign	Het
Chrna6	A	T	8: 27,406,683	S389T	probably benign	Het
Clic6	C	T	16: 92,492,157		probably benign	Het
Cmya5	G	A	13: 93,091,918	R2221*	probably null	Het
Coq8b	G	T	7: 27,233,505	C13F	probably benign	Het
Cspg4	T	A	9: 56,888,629	L1216Q	possibly damaging	Het
Decr1	C	A	4: 15,930,979	V118F	probably damaging	Het
Dlec1	A	T	9: 119,128,078	I796F	probably damaging	Het
Dnajc11	T	A	4: 151,979,941	D516E	probably damaging	Het
Dock8	G	A	19: 25,188,358	V1869M	probably damaging	Het
Dst	A	G	1: 34,188,738	D1982G	probably damaging	Het
Gm11808	C	T	4: 3,973,244	R106H	probably benign	Het
Gnptab	G	A	10: 88,414,595	D190N	probably benign	Het
Golga4	A	G	9: 118,556,845	K22E	probably damaging	Het
Hecw2	T	C	1: 53,813,222	*1579W	probably null	Het
Ica1l	A	G	1: 60,013,818		probably null	Het
Ift122	T	A	6: 115,890,588	L433Q	probably damaging	Het
Iqgap1	T	C	7: 80,762,567		probably null	Het
Klra13-ps	T	C	6: 130,291,269		noncoding transcript	Het
Mndal	A	T	1: 173,875,664	Y58*	probably null	Het
Mvb12b	G	C	2: 33,827,700	P172R	possibly damaging	Het
Ncapg	T	C	5: 45,671,212	F102L	probably damaging	Het
Olfr1447	T	A	19: 12,901,268	K171*	probably null	Het
Olfr390	T	C	11: 73,787,166	V76A	probably damaging	Het
Pde8a	A	T	7: 81,328,099	R713S	probably damaging	Het
Rbks	T	C	5: 31,624,568	N296S	probably benign	Het
Sema3c	G	A	5: 17,694,772	V421I	probably benign	Het
Tm9sf1	A	G	14: 55,638,108	V393A	possibly damaging	Het
Tubgcp2	G	A	7: 139,996,071	P893L	possibly damaging	Het
Vnn3	G	A	10: 23,856,326	R158H	probably benign	Het
Zfa-ps	G	T	10: 52,544,936		noncoding transcript	Het
Zfp414	T	C	17: 33,631,648		probably benign	Het
Zfp810	G	A	9: 22,278,745	T289I	probably damaging	Het
Zfp819	G	T	7: 43,617,785	R488L	probably damaging	Het
Zfp942	C	T	17: 21,928,304	G448D	probably benign	Het
Zscan12	A	G	13: 21,366,705	K165E	possibly damaging	Het

Other mutations in Olfr235

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02116:Olfr235	APN	19	12269010	missense	probably damaging	1.00
IGL03397:Olfr235	APN	19	12268502	missense	probably benign	0.03
R1239:Olfr235	UTSW	19	12268976	missense	probably damaging	1.00
R1416:Olfr235	UTSW	19	12268894	missense	probably benign	0.09
R1441:Olfr235	UTSW	19	12268386	nonsense	probably null
R1694:Olfr235	UTSW	19	12268917	missense	probably damaging	1.00
R1727:Olfr235	UTSW	19	12269001	missense	possibly damaging	0.70
R2422:Olfr235	UTSW	19	12268919	missense	probably damaging	0.99
R3439:Olfr235	UTSW	19	12268395	missense	possibly damaging	0.56
R4605:Olfr235	UTSW	19	12269168	makesense	probably null
R5147:Olfr235	UTSW	19	12268904	missense	probably damaging	1.00
R5382:Olfr235	UTSW	19	12268409	missense	possibly damaging	0.62
R5717:Olfr235	UTSW	19	12269156	missense	probably benign	0.13
R6455:Olfr235	UTSW	19	12268706	missense	probably damaging	0.97
R6880:Olfr235	UTSW	19	12268610	missense	probably benign	0.22
R7311:Olfr235	UTSW	19	12268704	missense	probably benign	0.29
R7384:Olfr235	UTSW	19	12269076	missense	possibly damaging	0.80
R8138:Olfr235	UTSW	19	12269072	missense	possibly damaging	0.61

Predicted Primers

PCR Primer
(F):5'- ACACTATGTGCTCAGATGGTGATG -3'
(R):5'- TGTCAAAACTAGAGGAGCCACC -3'

Sequencing Primer
(F):5'- CTCAGATGGTGATGGGAAGCTACAC -3'
(R):5'- CTAGAGGAGCCACCAGAGCTG -3'

Posted On

2015-08-18