Incidental Mutation 'R4545:Or5an11'
ID 333739
Institutional Source Beutler Lab
Gene Symbol Or5an11
Ensembl Gene ENSMUSG00000060049
Gene Name olfactory receptor family 5 subfamily AN member 11
Synonyms Olfr245, GA_x6K02T2LL2P-1028-792, Olfr232, GA_x6K02T03CT6-1-477, GA_x6K02T057QT-4025-4642, MOR214-3, Olfr235, MOR214-3
Accession Numbers
Essential gene? Probably non essential (E-score: 0.049) question?
Stock # R4545 (G1)
Quality Score 165
Status Not validated
Chromosome 19
Chromosomal Location 12245596-12246534 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 12246188 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 198 (V198A)
Ref Sequence ENSEMBL: ENSMUSP00000150313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073507] [ENSMUST00000207969] [ENSMUST00000214551] [ENSMUST00000214613] [ENSMUST00000214638] [ENSMUST00000215407]
AlphaFold E9Q9Z6
Predicted Effect possibly damaging
Transcript: ENSMUST00000073507
AA Change: V198A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000073203
Gene: ENSMUSG00000060049
AA Change: V198A

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 3.8e-56 PFAM
Pfam:7tm_1 42 309 1.2e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207842
AA Change: V198A
Predicted Effect possibly damaging
Transcript: ENSMUST00000207969
AA Change: V198A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214551
AA Change: V198A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214613
AA Change: V198A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214638
AA Change: V198A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215407
AA Change: V198A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 A C 13: 4,557,843 (GRCm39) V201G probably damaging Het
Atf7 A G 15: 102,442,762 (GRCm39) V449A probably benign Het
Ccr1 G A 9: 123,764,437 (GRCm39) A31V probably benign Het
Chrna6 A T 8: 27,896,711 (GRCm39) S389T probably benign Het
Clic6 C T 16: 92,289,045 (GRCm39) probably benign Het
Cmya5 G A 13: 93,228,426 (GRCm39) R2221* probably null Het
Coq8b G T 7: 26,932,930 (GRCm39) C13F probably benign Het
Cspg4 T A 9: 56,795,913 (GRCm39) L1216Q possibly damaging Het
Decr1 C A 4: 15,930,979 (GRCm39) V118F probably damaging Het
Dlec1 A T 9: 118,957,146 (GRCm39) I796F probably damaging Het
Dnajc11 T A 4: 152,064,398 (GRCm39) D516E probably damaging Het
Dock8 G A 19: 25,165,722 (GRCm39) V1869M probably damaging Het
Dst A G 1: 34,227,819 (GRCm39) D1982G probably damaging Het
Gnptab G A 10: 88,250,457 (GRCm39) D190N probably benign Het
Golga4 A G 9: 118,385,913 (GRCm39) K22E probably damaging Het
Hecw2 T C 1: 53,852,381 (GRCm39) *1579W probably null Het
Ica1l A G 1: 60,052,977 (GRCm39) probably null Het
Ift122 T A 6: 115,867,549 (GRCm39) L433Q probably damaging Het
Iqgap1 T C 7: 80,412,315 (GRCm39) probably null Het
Klra13-ps T C 6: 130,268,232 (GRCm39) noncoding transcript Het
Mndal A T 1: 173,703,230 (GRCm39) Y58* probably null Het
Mvb12b G C 2: 33,717,712 (GRCm39) P172R possibly damaging Het
Ncapg T C 5: 45,828,554 (GRCm39) F102L probably damaging Het
Or1e30 T C 11: 73,677,992 (GRCm39) V76A probably damaging Het
Or5b97 T A 19: 12,878,632 (GRCm39) K171* probably null Het
Pde8a A T 7: 80,977,847 (GRCm39) R713S probably damaging Het
Rbks T C 5: 31,781,912 (GRCm39) N296S probably benign Het
Sema3c G A 5: 17,899,770 (GRCm39) V421I probably benign Het
Tm9sf1 A G 14: 55,875,565 (GRCm39) V393A possibly damaging Het
Tubgcp2 G A 7: 139,575,984 (GRCm39) P893L possibly damaging Het
Uba52rt C T 4: 3,973,244 (GRCm39) R106H probably benign Het
Vnn3 G A 10: 23,732,224 (GRCm39) R158H probably benign Het
Zfa-ps G T 10: 52,421,032 (GRCm39) noncoding transcript Het
Zfp414 T C 17: 33,850,622 (GRCm39) probably benign Het
Zfp810 G A 9: 22,190,041 (GRCm39) T289I probably damaging Het
Zfp819 G T 7: 43,267,209 (GRCm39) R488L probably damaging Het
Zfp942 C T 17: 22,147,285 (GRCm39) G448D probably benign Het
Zscan12 A G 13: 21,550,875 (GRCm39) K165E possibly damaging Het
Other mutations in Or5an11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02116:Or5an11 APN 19 12,246,374 (GRCm39) missense probably damaging 1.00
IGL03397:Or5an11 APN 19 12,245,866 (GRCm39) missense probably benign 0.03
R1239:Or5an11 UTSW 19 12,246,340 (GRCm39) missense probably damaging 1.00
R1416:Or5an11 UTSW 19 12,246,258 (GRCm39) missense probably benign 0.09
R1441:Or5an11 UTSW 19 12,245,750 (GRCm39) nonsense probably null
R1694:Or5an11 UTSW 19 12,246,281 (GRCm39) missense probably damaging 1.00
R1727:Or5an11 UTSW 19 12,246,365 (GRCm39) missense possibly damaging 0.70
R2422:Or5an11 UTSW 19 12,246,283 (GRCm39) missense probably damaging 0.99
R3439:Or5an11 UTSW 19 12,245,759 (GRCm39) missense possibly damaging 0.56
R4605:Or5an11 UTSW 19 12,246,532 (GRCm39) makesense probably null
R5147:Or5an11 UTSW 19 12,246,268 (GRCm39) missense probably damaging 1.00
R5382:Or5an11 UTSW 19 12,245,773 (GRCm39) missense possibly damaging 0.62
R5717:Or5an11 UTSW 19 12,246,520 (GRCm39) missense probably benign 0.13
R6455:Or5an11 UTSW 19 12,246,070 (GRCm39) missense probably damaging 0.97
R6880:Or5an11 UTSW 19 12,245,974 (GRCm39) missense probably benign 0.22
R7311:Or5an11 UTSW 19 12,246,068 (GRCm39) missense probably benign 0.29
R7384:Or5an11 UTSW 19 12,246,440 (GRCm39) missense possibly damaging 0.80
R8138:Or5an11 UTSW 19 12,246,436 (GRCm39) missense possibly damaging 0.61
R9005:Or5an11 UTSW 19 12,245,704 (GRCm39) missense probably benign
R9118:Or5an11 UTSW 19 12,246,263 (GRCm39) missense probably benign 0.02
R9484:Or5an11 UTSW 19 12,245,735 (GRCm39) missense possibly damaging 0.58
R9549:Or5an11 UTSW 19 12,246,408 (GRCm39) missense probably benign 0.02
R9691:Or5an11 UTSW 19 12,246,379 (GRCm39) nonsense probably null
R9738:Or5an11 UTSW 19 12,245,869 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ACACTATGTGCTCAGATGGTGATG -3'
(R):5'- TGTCAAAACTAGAGGAGCCACC -3'

Sequencing Primer
(F):5'- CTCAGATGGTGATGGGAAGCTACAC -3'
(R):5'- CTAGAGGAGCCACCAGAGCTG -3'
Posted On 2015-08-18