Incidental Mutation 'R4545:Or5b97'
ID 333740
Institutional Source Beutler Lab
Gene Symbol Or5b97
Ensembl Gene ENSMUSG00000060303
Gene Name olfactory receptor family 5 subfamily B member 97
Synonyms MOR202-3, Olfr1447, GA_x6K02T2RE5P-3231251-3230331
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R4545 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 12878213-12879142 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 12878632 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 171 (K171*)
Ref Sequence ENSEMBL: ENSMUSP00000149392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071484] [ENSMUST00000208343] [ENSMUST00000216989]
AlphaFold Q8VFX3
Predicted Effect probably null
Transcript: ENSMUST00000071484
AA Change: K171*
SMART Domains Protein: ENSMUSP00000071419
Gene: ENSMUSG00000060303
AA Change: K171*

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 5.3e-50 PFAM
Pfam:7TM_GPCR_Srsx 36 306 2.1e-7 PFAM
Pfam:7tm_1 42 291 7.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208343
Predicted Effect probably null
Transcript: ENSMUST00000216989
AA Change: K171*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218013
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220222
Meta Mutation Damage Score 0.9659 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 A C 13: 4,557,843 (GRCm39) V201G probably damaging Het
Atf7 A G 15: 102,442,762 (GRCm39) V449A probably benign Het
Ccr1 G A 9: 123,764,437 (GRCm39) A31V probably benign Het
Chrna6 A T 8: 27,896,711 (GRCm39) S389T probably benign Het
Clic6 C T 16: 92,289,045 (GRCm39) probably benign Het
Cmya5 G A 13: 93,228,426 (GRCm39) R2221* probably null Het
Coq8b G T 7: 26,932,930 (GRCm39) C13F probably benign Het
Cspg4 T A 9: 56,795,913 (GRCm39) L1216Q possibly damaging Het
Decr1 C A 4: 15,930,979 (GRCm39) V118F probably damaging Het
Dlec1 A T 9: 118,957,146 (GRCm39) I796F probably damaging Het
Dnajc11 T A 4: 152,064,398 (GRCm39) D516E probably damaging Het
Dock8 G A 19: 25,165,722 (GRCm39) V1869M probably damaging Het
Dst A G 1: 34,227,819 (GRCm39) D1982G probably damaging Het
Gnptab G A 10: 88,250,457 (GRCm39) D190N probably benign Het
Golga4 A G 9: 118,385,913 (GRCm39) K22E probably damaging Het
Hecw2 T C 1: 53,852,381 (GRCm39) *1579W probably null Het
Ica1l A G 1: 60,052,977 (GRCm39) probably null Het
Ift122 T A 6: 115,867,549 (GRCm39) L433Q probably damaging Het
Iqgap1 T C 7: 80,412,315 (GRCm39) probably null Het
Klra13-ps T C 6: 130,268,232 (GRCm39) noncoding transcript Het
Mndal A T 1: 173,703,230 (GRCm39) Y58* probably null Het
Mvb12b G C 2: 33,717,712 (GRCm39) P172R possibly damaging Het
Ncapg T C 5: 45,828,554 (GRCm39) F102L probably damaging Het
Or1e30 T C 11: 73,677,992 (GRCm39) V76A probably damaging Het
Or5an11 T C 19: 12,246,188 (GRCm39) V198A possibly damaging Het
Pde8a A T 7: 80,977,847 (GRCm39) R713S probably damaging Het
Rbks T C 5: 31,781,912 (GRCm39) N296S probably benign Het
Sema3c G A 5: 17,899,770 (GRCm39) V421I probably benign Het
Tm9sf1 A G 14: 55,875,565 (GRCm39) V393A possibly damaging Het
Tubgcp2 G A 7: 139,575,984 (GRCm39) P893L possibly damaging Het
Uba52rt C T 4: 3,973,244 (GRCm39) R106H probably benign Het
Vnn3 G A 10: 23,732,224 (GRCm39) R158H probably benign Het
Zfa-ps G T 10: 52,421,032 (GRCm39) noncoding transcript Het
Zfp414 T C 17: 33,850,622 (GRCm39) probably benign Het
Zfp810 G A 9: 22,190,041 (GRCm39) T289I probably damaging Het
Zfp819 G T 7: 43,267,209 (GRCm39) R488L probably damaging Het
Zfp942 C T 17: 22,147,285 (GRCm39) G448D probably benign Het
Zscan12 A G 13: 21,550,875 (GRCm39) K165E possibly damaging Het
Other mutations in Or5b97
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Or5b97 APN 19 12,878,719 (GRCm39) missense probably benign 0.40
IGL01704:Or5b97 APN 19 12,879,103 (GRCm39) missense probably benign 0.01
IGL01767:Or5b97 APN 19 12,879,112 (GRCm39) missense probably benign 0.12
IGL01969:Or5b97 APN 19 12,878,416 (GRCm39) missense possibly damaging 0.69
IGL02435:Or5b97 APN 19 12,878,391 (GRCm39) missense probably damaging 1.00
IGL02666:Or5b97 APN 19 12,878,221 (GRCm39) missense probably benign
IGL03034:Or5b97 APN 19 12,879,121 (GRCm39) missense possibly damaging 0.94
IGL03221:Or5b97 APN 19 12,878,905 (GRCm39) missense probably damaging 1.00
R0315:Or5b97 UTSW 19 12,878,598 (GRCm39) missense possibly damaging 0.66
R0550:Or5b97 UTSW 19 12,879,164 (GRCm39) splice site probably null
R0729:Or5b97 UTSW 19 12,878,259 (GRCm39) missense probably damaging 0.97
R1381:Or5b97 UTSW 19 12,878,320 (GRCm39) missense probably benign 0.00
R1669:Or5b97 UTSW 19 12,878,652 (GRCm39) missense possibly damaging 0.79
R1775:Or5b97 UTSW 19 12,878,599 (GRCm39) missense probably benign 0.02
R1918:Or5b97 UTSW 19 12,878,215 (GRCm39) makesense probably null
R2377:Or5b97 UTSW 19 12,878,217 (GRCm39) missense possibly damaging 0.45
R2406:Or5b97 UTSW 19 12,878,991 (GRCm39) missense probably benign 0.11
R2471:Or5b97 UTSW 19 12,878,679 (GRCm39) missense probably benign 0.00
R2484:Or5b97 UTSW 19 12,879,005 (GRCm39) missense probably benign 0.06
R2656:Or5b97 UTSW 19 12,879,030 (GRCm39) missense probably benign 0.37
R3888:Or5b97 UTSW 19 12,878,497 (GRCm39) missense probably benign 0.00
R4250:Or5b97 UTSW 19 12,878,368 (GRCm39) missense probably benign 0.09
R4895:Or5b97 UTSW 19 12,878,251 (GRCm39) missense probably damaging 1.00
R4956:Or5b97 UTSW 19 12,878,963 (GRCm39) missense probably damaging 0.99
R4991:Or5b97 UTSW 19 12,878,815 (GRCm39) missense probably damaging 0.98
R5044:Or5b97 UTSW 19 12,878,365 (GRCm39) missense probably damaging 1.00
R5165:Or5b97 UTSW 19 12,878,564 (GRCm39) missense probably benign 0.00
R6025:Or5b97 UTSW 19 12,879,034 (GRCm39) missense probably benign 0.10
R6135:Or5b97 UTSW 19 12,878,803 (GRCm39) missense probably damaging 0.97
R6459:Or5b97 UTSW 19 12,878,369 (GRCm39) missense possibly damaging 0.94
R6733:Or5b97 UTSW 19 12,878,605 (GRCm39) missense probably damaging 1.00
R6789:Or5b97 UTSW 19 12,878,653 (GRCm39) missense probably benign 0.21
R6923:Or5b97 UTSW 19 12,878,676 (GRCm39) missense probably benign 0.04
R7310:Or5b97 UTSW 19 12,878,637 (GRCm39) missense probably damaging 1.00
R8552:Or5b97 UTSW 19 12,879,096 (GRCm39) missense probably damaging 0.98
R8699:Or5b97 UTSW 19 12,878,828 (GRCm39) missense possibly damaging 0.59
R8735:Or5b97 UTSW 19 12,878,274 (GRCm39) missense possibly damaging 0.85
R8955:Or5b97 UTSW 19 12,878,578 (GRCm39) missense probably benign 0.01
R9626:Or5b97 UTSW 19 12,878,600 (GRCm39) missense possibly damaging 0.88
R9631:Or5b97 UTSW 19 12,878,502 (GRCm39) missense possibly damaging 0.69
R9694:Or5b97 UTSW 19 12,879,021 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGGCACAGGTGGATATAGCC -3'
(R):5'- TACTGTGGAGAACTATCTGTTGGC -3'

Sequencing Primer
(F):5'- TCCTGAAGCTGAGTGCATC -3'
(R):5'- GAGAACTATCTGTTGGCCTCAATG -3'
Posted On 2015-08-18