Incidental Mutation 'R4545:Olfr1447'
ID333740
Institutional Source Beutler Lab
Gene Symbol Olfr1447
Ensembl Gene ENSMUSG00000060303
Gene Nameolfactory receptor 1447
SynonymsGA_x6K02T2RE5P-3231251-3230331, MOR202-3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R4545 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location12899434-12903743 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 12901268 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 171 (K171*)
Ref Sequence ENSEMBL: ENSMUSP00000149392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071484] [ENSMUST00000208343] [ENSMUST00000216989]
Predicted Effect probably null
Transcript: ENSMUST00000071484
AA Change: K171*
SMART Domains Protein: ENSMUSP00000071419
Gene: ENSMUSG00000060303
AA Change: K171*

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 5.3e-50 PFAM
Pfam:7TM_GPCR_Srsx 36 306 2.1e-7 PFAM
Pfam:7tm_1 42 291 7.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208343
Predicted Effect probably null
Transcript: ENSMUST00000216989
AA Change: K171*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218013
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220222
Meta Mutation Damage Score 0.9659 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Atf7 A G 15: 102,534,327 V449A probably benign Het
Ccr1 G A 9: 123,964,400 A31V probably benign Het
Chrna6 A T 8: 27,406,683 S389T probably benign Het
Clic6 C T 16: 92,492,157 probably benign Het
Cmya5 G A 13: 93,091,918 R2221* probably null Het
Coq8b G T 7: 27,233,505 C13F probably benign Het
Cspg4 T A 9: 56,888,629 L1216Q possibly damaging Het
Decr1 C A 4: 15,930,979 V118F probably damaging Het
Dlec1 A T 9: 119,128,078 I796F probably damaging Het
Dnajc11 T A 4: 151,979,941 D516E probably damaging Het
Dock8 G A 19: 25,188,358 V1869M probably damaging Het
Dst A G 1: 34,188,738 D1982G probably damaging Het
Gm11808 C T 4: 3,973,244 R106H probably benign Het
Gnptab G A 10: 88,414,595 D190N probably benign Het
Golga4 A G 9: 118,556,845 K22E probably damaging Het
Hecw2 T C 1: 53,813,222 *1579W probably null Het
Ica1l A G 1: 60,013,818 probably null Het
Ift122 T A 6: 115,890,588 L433Q probably damaging Het
Iqgap1 T C 7: 80,762,567 probably null Het
Klra13-ps T C 6: 130,291,269 noncoding transcript Het
Mndal A T 1: 173,875,664 Y58* probably null Het
Mvb12b G C 2: 33,827,700 P172R possibly damaging Het
Ncapg T C 5: 45,671,212 F102L probably damaging Het
Olfr235 T C 19: 12,268,824 V198A possibly damaging Het
Olfr390 T C 11: 73,787,166 V76A probably damaging Het
Pde8a A T 7: 81,328,099 R713S probably damaging Het
Rbks T C 5: 31,624,568 N296S probably benign Het
Sema3c G A 5: 17,694,772 V421I probably benign Het
Tm9sf1 A G 14: 55,638,108 V393A possibly damaging Het
Tubgcp2 G A 7: 139,996,071 P893L possibly damaging Het
Vnn3 G A 10: 23,856,326 R158H probably benign Het
Zfa-ps G T 10: 52,544,936 noncoding transcript Het
Zfp414 T C 17: 33,631,648 probably benign Het
Zfp810 G A 9: 22,278,745 T289I probably damaging Het
Zfp819 G T 7: 43,617,785 R488L probably damaging Het
Zfp942 C T 17: 21,928,304 G448D probably benign Het
Zscan12 A G 13: 21,366,705 K165E possibly damaging Het
Other mutations in Olfr1447
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Olfr1447 APN 19 12901355 missense probably benign 0.40
IGL01704:Olfr1447 APN 19 12901739 missense probably benign 0.01
IGL01767:Olfr1447 APN 19 12901748 missense probably benign 0.12
IGL01969:Olfr1447 APN 19 12901052 missense possibly damaging 0.69
IGL02435:Olfr1447 APN 19 12901027 missense probably damaging 1.00
IGL02666:Olfr1447 APN 19 12900857 missense probably benign
IGL03034:Olfr1447 APN 19 12901757 missense possibly damaging 0.94
IGL03221:Olfr1447 APN 19 12901541 missense probably damaging 1.00
R0315:Olfr1447 UTSW 19 12901234 missense possibly damaging 0.66
R0550:Olfr1447 UTSW 19 12901800 splice site probably null
R0729:Olfr1447 UTSW 19 12900895 missense probably damaging 0.97
R1381:Olfr1447 UTSW 19 12900956 missense probably benign 0.00
R1669:Olfr1447 UTSW 19 12901288 missense possibly damaging 0.79
R1775:Olfr1447 UTSW 19 12901235 missense probably benign 0.02
R1918:Olfr1447 UTSW 19 12900851 makesense probably null
R2377:Olfr1447 UTSW 19 12900853 missense possibly damaging 0.45
R2406:Olfr1447 UTSW 19 12901627 missense probably benign 0.11
R2471:Olfr1447 UTSW 19 12901315 missense probably benign 0.00
R2484:Olfr1447 UTSW 19 12901641 missense probably benign 0.06
R2656:Olfr1447 UTSW 19 12901666 missense probably benign 0.37
R3888:Olfr1447 UTSW 19 12901133 missense probably benign 0.00
R4250:Olfr1447 UTSW 19 12901004 missense probably benign 0.09
R4895:Olfr1447 UTSW 19 12900887 missense probably damaging 1.00
R4956:Olfr1447 UTSW 19 12901599 missense probably damaging 0.99
R4991:Olfr1447 UTSW 19 12901451 missense probably damaging 0.98
R5044:Olfr1447 UTSW 19 12901001 missense probably damaging 1.00
R5165:Olfr1447 UTSW 19 12901200 missense probably benign 0.00
R6025:Olfr1447 UTSW 19 12901670 missense probably benign 0.10
R6135:Olfr1447 UTSW 19 12901439 missense probably damaging 0.97
R6459:Olfr1447 UTSW 19 12901005 missense possibly damaging 0.94
R6733:Olfr1447 UTSW 19 12901241 missense probably damaging 1.00
R6789:Olfr1447 UTSW 19 12901289 missense probably benign 0.21
R6923:Olfr1447 UTSW 19 12901312 missense probably benign 0.04
R7310:Olfr1447 UTSW 19 12901273 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCACAGGTGGATATAGCC -3'
(R):5'- TACTGTGGAGAACTATCTGTTGGC -3'

Sequencing Primer
(F):5'- TCCTGAAGCTGAGTGCATC -3'
(R):5'- GAGAACTATCTGTTGGCCTCAATG -3'
Posted On2015-08-18