Mutagenetix > Incidental Mutations

Incidental Mutation 'R4546:Lepr'

333760

Institutional Source

Beutler Lab

Gene Symbol

Lepr

Ensembl Gene

ENSMUSG00000057722

Gene Name

leptin receptor

Synonyms

obl, Leprb, Obr, obese-like, OB-RGRP, Modb1, leptin receptor gene-related protein, LEPROT

MMRRC Submission

041780-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4546 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101717404-101815352 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 101814641 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 954 (I954N)

Ref Sequence

ENSEMBL: ENSMUSP00000037385 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037552] [ENSMUST00000106921]

Predicted Effect

probably benign
Transcript: ENSMUST00000037552
AA Change: I954N

PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000037385
Gene: ENSMUSG00000057722
AA Change: I954N

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
FN3	236	315	1.5e-5	SMART
Pfam:Lep_receptor_Ig	328	418	6.3e-23	PFAM
FN3	535	618	4.93e-1	SMART
FN3	641	721	3.25e1	SMART
FN3	736	818	2.35e0	SMART
transmembrane domain	838	860	N/A	INTRINSIC
low complexity region	908	921	N/A	INTRINSIC
low complexity region	1050	1065	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106921

SMART Domains

Protein: ENSMUSP00000102534
Gene: ENSMUSG00000057722

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
FN3	236	315	1.5e-5	SMART
Pfam:Lep_receptor_Ig	329	420	2.6e-29	PFAM
FN3	535	618	4.93e-1	SMART
FN3	641	721	3.25e1	SMART
FN3	736	818	2.35e0	SMART
transmembrane domain	838	860	N/A	INTRINSIC

Meta Mutation Damage Score

0.1579

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

97% (65/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte-specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Mutations in this gene have been associated with obesity and pituitary dysfunction. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. It is noteworthy that this gene and LEPROT gene (GeneID:54741) share the same promoter and the first 2 exons, however, encode distinct proteins (PMID:9207021).[provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous mutants are hyperphagic, low-activity, poorly cold-adapted, sterile and have enhanced fat conversion. They are obese, hyperinsulinemic and, on certain strains, severely hyperglycemic. Heterozygotes are normal but resistant to prolonged fasting. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930012K11Rik	G	A	14: 70,156,478	S236L	probably benign	Het
Alg9	C	T	9: 50,805,354	T409M	possibly damaging	Het
Alpi	T	A	1: 87,099,117	Y413F	probably damaging	Het
Asmt	T	C	X: 170,676,495		probably null	Het
Atf7	A	G	15: 102,534,327	V449A	probably benign	Het
Bnc2	A	G	4: 84,291,976	F744L	probably benign	Het
Ccnyl1	G	T	1: 64,723,576	M347I	probably benign	Het
Cdk13	T	C	13: 17,766,574	K21R	probably damaging	Het
Cenpf	A	C	1: 189,654,650	L1811R	probably damaging	Het
Cr2	A	G	1: 195,171,041	I43T	possibly damaging	Het
Cspg4	T	A	9: 56,888,629	L1216Q	possibly damaging	Het
Cylc2	C	G	4: 51,229,651	T331R	unknown	Het
Cylc2	A	T	4: 51,229,840	D394V	unknown	Het
Dcaf8	T	C	1: 172,179,893		probably benign	Het
Dlec1	A	T	9: 119,128,078	I796F	probably damaging	Het
Dnah12	A	T	14: 26,773,014	Q1343L	probably damaging	Het
Dnajc21	T	C	15: 10,447,097	R522G	probably benign	Het
F2rl3	C	T	8: 72,762,583	A146V	probably benign	Het
Fastkd1	C	T	2: 69,712,311	E51K	probably damaging	Het
Glrb	T	C	3: 80,879,686	S57G	probably damaging	Het
Gm10093	A	T	17: 78,492,959	T460S	probably benign	Het
Gm4737	C	T	16: 46,153,967	C349Y	possibly damaging	Het
Gm5507	T	A	18: 53,984,337		noncoding transcript	Het
Golga4	A	G	9: 118,556,845	K22E	probably damaging	Het
Ift122	T	A	6: 115,890,588	L433Q	probably damaging	Het
Il21r	A	G	7: 125,628,899	R181G	probably damaging	Het
Il5ra	G	T	6: 106,738,498	S125*	probably null	Het
Kdm7a	T	C	6: 39,175,472	R97G	probably benign	Het
Lims1	T	C	10: 58,418,790		probably benign	Het
Maats1	C	T	16: 38,335,523	V113I	probably benign	Het
Mest	T	C	6: 30,740,680	W13R	probably damaging	Het
Mfn2	A	G	4: 147,887,452	V224A	probably benign	Het
Muc15	T	C	2: 110,737,499	S330P	probably damaging	Het
Ncapg	T	C	5: 45,671,212	F102L	probably damaging	Het
Nkd2	T	C	13: 73,823,356	D187G	probably benign	Het
Nphp1	C	T	2: 127,766,019		probably null	Het
Olfr1129	T	C	2: 87,575,186	F34S	probably benign	Het
Olfr378	T	C	11: 73,425,186	N266D	probably benign	Het
Olfr446	C	T	6: 42,927,414	S61L	probably damaging	Het
Osbpl6	T	C	2: 76,584,492	V409A	possibly damaging	Het
Pdhx	A	T	2: 103,073,397	L18Q	probably null	Het
Pear1	C	T	3: 87,754,661	G469D	probably damaging	Het
Plec	T	C	15: 76,181,557	T1506A	probably benign	Het
Plod3	T	A	5: 136,988,947	D192E	possibly damaging	Het
Rbks	T	C	5: 31,624,568	N296S	probably benign	Het
Sema3c	G	A	5: 17,694,772	V421I	probably benign	Het
Slc15a4	A	G	5: 127,604,536		probably null	Het
Slc7a8	C	G	14: 54,735,790	G240A	possibly damaging	Het
Tmem200c	A	G	17: 68,842,171	D583G	probably benign	Het
Trpm6	A	G	19: 18,832,477	Y1079C	probably damaging	Het
Ttn	T	C	2: 76,822,588		probably null	Het
Vcp	T	C	4: 42,988,813		probably benign	Het
Vmn2r78	T	C	7: 86,954,603	V663A	probably damaging	Het
Vmn2r9	T	G	5: 108,847,685	M366L	probably benign	Het
Wdr11	A	G	7: 129,629,005	E878G	probably damaging	Het
Zan	C	G	5: 137,383,834	M5150I	unknown	Het

Other mutations in Lepr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Lepr	APN	4	101815035	missense	probably benign
IGL01111:Lepr	APN	4	101814655	missense	possibly damaging	0.77
IGL01324:Lepr	APN	4	101768068	missense	probably benign	0.23
IGL01372:Lepr	APN	4	101735577	missense	possibly damaging	0.67
IGL01626:Lepr	APN	4	101733534	missense	probably benign	0.10
IGL01733:Lepr	APN	4	101765082	missense	probably benign	0.00
IGL01815:Lepr	APN	4	101814790	missense	possibly damaging	0.49
IGL01899:Lepr	APN	4	101779987	missense	possibly damaging	0.86
IGL02138:Lepr	APN	4	101768067	missense	probably damaging	0.98
IGL02161:Lepr	APN	4	101745678	missense	probably damaging	0.97
IGL02653:Lepr	APN	4	101764944	missense	probably benign	0.44
IGL02735:Lepr	APN	4	101782638	missense	probably damaging	1.00
IGL03035:Lepr	APN	4	101764980	missense	probably damaging	1.00
IGL03083:Lepr	APN	4	101814679	nonsense	probably null
IGL03160:Lepr	APN	4	101764906	missense	probably damaging	1.00
business_class	UTSW	4	101764872	missense	probably damaging	1.00
cherub	UTSW	4	101768063	missense	probably benign	0.25
clodhopper	UTSW	4	101765290	splice site	probably null
donner	UTSW	4	101815201	missense	probably damaging	1.00
fluffy	UTSW	4	101792023	missense	probably damaging	1.00
giant	UTSW	4	101765152	critical splice donor site	probably null
gordo	UTSW	4	101765305	missense	probably damaging	0.97
Immunoglutton	UTSW	4	101765301	splice site	probably benign
Jumbo_shrimp	UTSW	4	101764954	nonsense	probably null
odd	UTSW	4	101728075	splice site	probably benign
paleo	UTSW	4	101745645	missense	possibly damaging	0.94
well-upholstered	UTSW	4	101772959	synonymous	probably benign
worldly	UTSW	4	101768228	missense	possibly damaging	0.96
PIT4651001:Lepr	UTSW	4	101791997	missense	probably damaging	1.00
PIT4696001:Lepr	UTSW	4	101779983	missense	probably benign	0.10
R0140:Lepr	UTSW	4	101768067	missense	probably damaging	1.00
R0197:Lepr	UTSW	4	101752152	missense	possibly damaging	0.64
R0279:Lepr	UTSW	4	101750344	missense	probably benign	0.05
R0487:Lepr	UTSW	4	101768093	nonsense	probably null
R0498:Lepr	UTSW	4	101745692	missense	probably benign	0.01
R0506:Lepr	UTSW	4	101773010	splice site	probably benign
R0512:Lepr	UTSW	4	101792019	missense	probably damaging	1.00
R0512:Lepr	UTSW	4	101814704	missense	possibly damaging	0.87
R0726:Lepr	UTSW	4	101764934	missense	probably benign	0.01
R1054:Lepr	UTSW	4	101782596	missense	probably damaging	0.97
R1109:Lepr	UTSW	4	101771355	missense	probably damaging	1.00
R1398:Lepr	UTSW	4	101792019	missense	probably damaging	1.00
R1464:Lepr	UTSW	4	101735681	missense	probably benign	0.08
R1464:Lepr	UTSW	4	101735681	missense	probably benign	0.08
R1519:Lepr	UTSW	4	101789344	missense	probably damaging	0.97
R1602:Lepr	UTSW	4	101745645	missense	possibly damaging	0.94
R1830:Lepr	UTSW	4	101735677	missense	probably damaging	1.00
R1850:Lepr	UTSW	4	101733423	missense	possibly damaging	0.67
R1918:Lepr	UTSW	4	101772836	missense	probably benign	0.08
R1928:Lepr	UTSW	4	101782730	splice site	probably benign
R2099:Lepr	UTSW	4	101772988	missense	probably damaging	1.00
R2102:Lepr	UTSW	4	101772981	missense	possibly damaging	0.95
R2175:Lepr	UTSW	4	101765379	missense	probably benign	0.01
R2254:Lepr	UTSW	4	101815112	missense	probably benign	0.26
R2396:Lepr	UTSW	4	101733528	missense	probably benign	0.19
R2508:Lepr	UTSW	4	101790896	missense	probably damaging	0.98
R2571:Lepr	UTSW	4	101768172	missense	possibly damaging	0.96
R3790:Lepr	UTSW	4	101790914	splice site	probably benign
R3882:Lepr	UTSW	4	101815265	missense	probably damaging	1.00
R3933:Lepr	UTSW	4	101765301	splice site	probably benign
R4211:Lepr	UTSW	4	101733414	missense	probably benign	0.19
R4343:Lepr	UTSW	4	101765152	critical splice donor site	probably null
R4345:Lepr	UTSW	4	101765152	critical splice donor site	probably null
R4544:Lepr	UTSW	4	101768228	missense	possibly damaging	0.96
R4724:Lepr	UTSW	4	101765365	nonsense	probably null
R4797:Lepr	UTSW	4	101780047	missense	possibly damaging	0.90
R4860:Lepr	UTSW	4	101789337	missense	probably benign	0.14
R4860:Lepr	UTSW	4	101789337	missense	probably benign	0.14
R4929:Lepr	UTSW	4	101815117	missense	probably benign	0.00
R4939:Lepr	UTSW	4	101733438	missense	possibly damaging	0.78
R5377:Lepr	UTSW	4	101815019	missense	possibly damaging	0.71
R5520:Lepr	UTSW	4	101745537	missense	probably benign	0.00
R5966:Lepr	UTSW	4	101792127	intron	probably benign
R6092:Lepr	UTSW	4	101792023	missense	probably damaging	1.00
R6130:Lepr	UTSW	4	101765372	missense	probably damaging	0.99
R6168:Lepr	UTSW	4	101735592	missense	probably damaging	0.99
R6232:Lepr	UTSW	4	101814391	intron	probably null
R6380:Lepr	UTSW	4	101764954	nonsense	probably null
R6427:Lepr	UTSW	4	101774257	missense	possibly damaging	0.47
R6428:Lepr	UTSW	4	101780098	missense	probably damaging	1.00
R6641:Lepr	UTSW	4	101765305	missense	probably damaging	0.97
R6650:Lepr	UTSW	4	101815201	missense	probably damaging	1.00
R6859:Lepr	UTSW	4	101765290	splice site	probably null
R7023:Lepr	UTSW	4	101789287	missense	probably damaging	1.00
R7145:Lepr	UTSW	4	101752197	missense	probably benign	0.00
R7174:Lepr	UTSW	4	101750338	missense	probably benign	0.01
R7179:Lepr	UTSW	4	101745659	missense	probably benign	0.06
R7189:Lepr	UTSW	4	101814764	missense	probably benign	0.00
R7426:Lepr	UTSW	4	101745656	missense	probably benign	0.03
R7531:Lepr	UTSW	4	101752175	missense	probably damaging	1.00
R7620:Lepr	UTSW	4	101752073	missense	probably benign	0.41
R7804:Lepr	UTSW	4	101782586	missense	probably damaging	1.00
X0026:Lepr	UTSW	4	101733327	missense	possibly damaging	0.47

Predicted Primers

PCR Primer
(F):5'- CCAAGCATGCAGAATCAGTG -3'
(R):5'- AAATGTCTGGGCCTCTGTC -3'

Sequencing Primer
(F):5'- GCAGAATCAGTGATATTTGGTCCTC -3'
(R):5'- ACTGCCTCAGTGGGGAATGATTAC -3'

Posted On

2015-08-18