Incidental Mutation 'R4546:Sema3c'
ID 333762
Institutional Source Beutler Lab
Gene Symbol Sema3c
Ensembl Gene ENSMUSG00000028780
Gene Name sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C
Synonyms Semae, 1110036B02Rik
MMRRC Submission 041780-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4546 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 17779814-17935266 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 17899770 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 421 (V421I)
Ref Sequence ENSEMBL: ENSMUSP00000030568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030568]
AlphaFold Q62181
Predicted Effect probably benign
Transcript: ENSMUST00000030568
AA Change: V421I

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000030568
Gene: ENSMUSG00000028780
AA Change: V421I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Sema 54 495 1.16e-200 SMART
PSI 513 565 2.87e-13 SMART
IG 577 662 7.08e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115271
Meta Mutation Damage Score 0.0726 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (65/67)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU mutation exhibit perinatal lethality, hypopigmentation and abnormal heart development. Mice homozygous for a knock-out allele exhibit prenatal lethality associated with heart defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik G A 14: 70,393,927 (GRCm39) S236L probably benign Het
Ahcyl C T 16: 45,974,330 (GRCm39) C349Y possibly damaging Het
Alg9 C T 9: 50,716,654 (GRCm39) T409M possibly damaging Het
Alpi T A 1: 87,026,839 (GRCm39) Y413F probably damaging Het
Asmt T C X: 169,110,230 (GRCm39) probably null Het
Atf7 A G 15: 102,442,762 (GRCm39) V449A probably benign Het
Bnc2 A G 4: 84,210,213 (GRCm39) F744L probably benign Het
Ccnyl1 G T 1: 64,762,735 (GRCm39) M347I probably benign Het
Cdk13 T C 13: 17,941,159 (GRCm39) K21R probably damaging Het
Cenpf A C 1: 189,386,847 (GRCm39) L1811R probably damaging Het
Cfap91 C T 16: 38,155,885 (GRCm39) V113I probably benign Het
Cr2 A G 1: 194,853,349 (GRCm39) I43T possibly damaging Het
Cspg4 T A 9: 56,795,913 (GRCm39) L1216Q possibly damaging Het
Cylc2 A T 4: 51,229,840 (GRCm39) D394V unknown Het
Cylc2 C G 4: 51,229,651 (GRCm39) T331R unknown Het
Dcaf8 T C 1: 172,007,460 (GRCm39) probably benign Het
Dlec1 A T 9: 118,957,146 (GRCm39) I796F probably damaging Het
Dnah12 A T 14: 26,494,971 (GRCm39) Q1343L probably damaging Het
Dnajc21 T C 15: 10,447,183 (GRCm39) R522G probably benign Het
F2rl3 C T 8: 73,489,211 (GRCm39) A146V probably benign Het
Fastkd1 C T 2: 69,542,655 (GRCm39) E51K probably damaging Het
Glrb T C 3: 80,786,993 (GRCm39) S57G probably damaging Het
Gm5507 T A 18: 54,117,409 (GRCm39) noncoding transcript Het
Golga4 A G 9: 118,385,913 (GRCm39) K22E probably damaging Het
Hdac1-ps A T 17: 78,800,388 (GRCm39) T460S probably benign Het
Ift122 T A 6: 115,867,549 (GRCm39) L433Q probably damaging Het
Il21r A G 7: 125,228,071 (GRCm39) R181G probably damaging Het
Il5ra G T 6: 106,715,459 (GRCm39) S125* probably null Het
Kdm7a T C 6: 39,152,406 (GRCm39) R97G probably benign Het
Lepr T A 4: 101,671,838 (GRCm39) I954N probably benign Het
Lims1 T C 10: 58,254,612 (GRCm39) probably benign Het
Mest T C 6: 30,740,679 (GRCm39) W13R probably damaging Het
Mfn2 A G 4: 147,971,909 (GRCm39) V224A probably benign Het
Muc15 T C 2: 110,567,844 (GRCm39) S330P probably damaging Het
Ncapg T C 5: 45,828,554 (GRCm39) F102L probably damaging Het
Nkd2 T C 13: 73,971,475 (GRCm39) D187G probably benign Het
Nphp1 C T 2: 127,607,939 (GRCm39) probably null Het
Or10ag59 T C 2: 87,405,530 (GRCm39) F34S probably benign Het
Or1e19 T C 11: 73,316,012 (GRCm39) N266D probably benign Het
Or2a12 C T 6: 42,904,348 (GRCm39) S61L probably damaging Het
Osbpl6 T C 2: 76,414,836 (GRCm39) V409A possibly damaging Het
Pdhx A T 2: 102,903,742 (GRCm39) L18Q probably null Het
Pear1 C T 3: 87,661,968 (GRCm39) G469D probably damaging Het
Plec T C 15: 76,065,757 (GRCm39) T1506A probably benign Het
Plod3 T A 5: 137,017,801 (GRCm39) D192E possibly damaging Het
Rbks T C 5: 31,781,912 (GRCm39) N296S probably benign Het
Slc15a4 A G 5: 127,681,600 (GRCm39) probably null Het
Slc7a8 C G 14: 54,973,247 (GRCm39) G240A possibly damaging Het
Tmem200c A G 17: 69,149,166 (GRCm39) D583G probably benign Het
Trpm6 A G 19: 18,809,841 (GRCm39) Y1079C probably damaging Het
Ttn T C 2: 76,652,932 (GRCm39) probably null Het
Vcp T C 4: 42,988,813 (GRCm39) probably benign Het
Vmn2r78 T C 7: 86,603,811 (GRCm39) V663A probably damaging Het
Vmn2r9 T G 5: 108,995,551 (GRCm39) M366L probably benign Het
Wdr11 A G 7: 129,230,729 (GRCm39) E878G probably damaging Het
Zan C G 5: 137,382,096 (GRCm39) M5150I unknown Het
Other mutations in Sema3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Sema3c APN 5 17,899,858 (GRCm39) missense probably damaging 1.00
IGL01528:Sema3c APN 5 17,919,413 (GRCm39) missense probably benign
IGL01618:Sema3c APN 5 17,877,504 (GRCm39) missense probably damaging 1.00
IGL01730:Sema3c APN 5 17,916,434 (GRCm39) missense probably benign 0.01
IGL01762:Sema3c APN 5 17,899,849 (GRCm39) missense possibly damaging 0.81
IGL02049:Sema3c APN 5 17,926,923 (GRCm39) splice site probably benign
IGL02249:Sema3c APN 5 17,867,961 (GRCm39) missense probably damaging 1.00
IGL02657:Sema3c APN 5 17,867,972 (GRCm39) missense probably damaging 1.00
IGL02657:Sema3c APN 5 17,781,866 (GRCm39) start codon destroyed possibly damaging 0.71
IGL03213:Sema3c APN 5 17,899,637 (GRCm39) splice site probably benign
PIT4651001:Sema3c UTSW 5 17,899,731 (GRCm39) missense probably benign 0.37
R0031:Sema3c UTSW 5 17,899,726 (GRCm39) missense probably damaging 1.00
R0558:Sema3c UTSW 5 17,919,413 (GRCm39) missense probably benign 0.00
R0964:Sema3c UTSW 5 17,926,907 (GRCm39) missense probably damaging 1.00
R1164:Sema3c UTSW 5 17,883,312 (GRCm39) missense probably benign 0.40
R1351:Sema3c UTSW 5 17,883,334 (GRCm39) missense possibly damaging 0.60
R1368:Sema3c UTSW 5 17,883,330 (GRCm39) missense possibly damaging 0.96
R1480:Sema3c UTSW 5 17,887,029 (GRCm39) missense possibly damaging 0.57
R1880:Sema3c UTSW 5 17,932,464 (GRCm39) nonsense probably null
R1916:Sema3c UTSW 5 17,932,399 (GRCm39) missense probably benign 0.06
R3934:Sema3c UTSW 5 17,886,938 (GRCm39) missense probably damaging 0.97
R4284:Sema3c UTSW 5 17,883,345 (GRCm39) missense probably benign 0.01
R4449:Sema3c UTSW 5 17,781,844 (GRCm39) start gained probably benign
R4545:Sema3c UTSW 5 17,899,770 (GRCm39) missense probably benign 0.01
R4660:Sema3c UTSW 5 17,877,511 (GRCm39) missense probably damaging 1.00
R4890:Sema3c UTSW 5 17,880,157 (GRCm39) missense probably benign 0.00
R4937:Sema3c UTSW 5 17,899,684 (GRCm39) missense probably benign 0.01
R5065:Sema3c UTSW 5 17,932,615 (GRCm39) missense possibly damaging 0.89
R5145:Sema3c UTSW 5 17,932,615 (GRCm39) missense possibly damaging 0.89
R5452:Sema3c UTSW 5 17,922,068 (GRCm39) critical splice donor site probably null
R5586:Sema3c UTSW 5 17,916,422 (GRCm39) missense probably damaging 0.99
R5811:Sema3c UTSW 5 17,880,188 (GRCm39) splice site probably null
R5886:Sema3c UTSW 5 17,886,984 (GRCm39) missense possibly damaging 0.90
R6120:Sema3c UTSW 5 17,932,630 (GRCm39) missense probably benign 0.00
R6191:Sema3c UTSW 5 17,858,804 (GRCm39) missense probably damaging 1.00
R6318:Sema3c UTSW 5 17,877,430 (GRCm39) missense probably damaging 0.96
R6416:Sema3c UTSW 5 17,781,959 (GRCm39) missense probably damaging 0.99
R6441:Sema3c UTSW 5 17,929,130 (GRCm39) missense possibly damaging 0.96
R6816:Sema3c UTSW 5 17,875,463 (GRCm39) missense probably benign 0.36
R7146:Sema3c UTSW 5 17,899,701 (GRCm39) missense probably benign 0.22
R7526:Sema3c UTSW 5 17,932,594 (GRCm39) missense possibly damaging 0.46
R7832:Sema3c UTSW 5 17,899,845 (GRCm39) missense probably damaging 0.99
R8034:Sema3c UTSW 5 17,932,480 (GRCm39) missense probably damaging 1.00
R8053:Sema3c UTSW 5 17,860,020 (GRCm39) missense probably benign 0.00
R8076:Sema3c UTSW 5 17,932,362 (GRCm39) missense probably benign 0.00
R8264:Sema3c UTSW 5 17,881,537 (GRCm39) intron probably benign
R8359:Sema3c UTSW 5 17,858,726 (GRCm39) missense possibly damaging 0.56
R8437:Sema3c UTSW 5 17,867,936 (GRCm39) missense probably damaging 0.99
R9174:Sema3c UTSW 5 17,868,039 (GRCm39) critical splice donor site probably null
R9295:Sema3c UTSW 5 17,932,495 (GRCm39) missense probably benign 0.09
R9477:Sema3c UTSW 5 17,921,981 (GRCm39) missense
R9599:Sema3c UTSW 5 17,919,452 (GRCm39) critical splice donor site probably null
R9702:Sema3c UTSW 5 17,858,828 (GRCm39) missense probably damaging 1.00
Z1176:Sema3c UTSW 5 17,932,517 (GRCm39) missense probably benign 0.04
Z1177:Sema3c UTSW 5 17,922,029 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGCTCAAGACTCTCCTTG -3'
(R):5'- TCAGGTAAAGACTAAACGCCTC -3'

Sequencing Primer
(F):5'- GTCCTTCTCAGAAGATCTTCAATG -3'
(R):5'- GGTAAAGACTAAACGCCTCACTAAAG -3'
Posted On 2015-08-18