Incidental Mutation 'R4546:Olfr446'
ID333772
Institutional Source Beutler Lab
Gene Symbol Olfr446
Ensembl Gene ENSMUSG00000073111
Gene Nameolfactory receptor 446
SynonymsGA_x6K02T2P3E9-4632269-4631343, MOR261-12
MMRRC Submission 041780-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R4546 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location42921377-42931141 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 42927414 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 61 (S61L)
Ref Sequence ENSEMBL: ENSMUSP00000150255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101461] [ENSMUST00000215369] [ENSMUST00000215686] [ENSMUST00000216199]
Predicted Effect probably damaging
Transcript: ENSMUST00000101461
AA Change: S61L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099005
Gene: ENSMUSG00000073111
AA Change: S61L

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 1.7e-62 PFAM
Pfam:7TM_GPCR_Srsx 32 282 1.7e-5 PFAM
Pfam:7tm_1 38 287 3.2e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215369
AA Change: S61L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000215686
AA Change: S61L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000216199
AA Change: S61L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.4304 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik G A 14: 70,156,478 S236L probably benign Het
Alg9 C T 9: 50,805,354 T409M possibly damaging Het
Alpi T A 1: 87,099,117 Y413F probably damaging Het
Asmt T C X: 170,676,495 probably null Het
Atf7 A G 15: 102,534,327 V449A probably benign Het
Bnc2 A G 4: 84,291,976 F744L probably benign Het
Ccnyl1 G T 1: 64,723,576 M347I probably benign Het
Cdk13 T C 13: 17,766,574 K21R probably damaging Het
Cenpf A C 1: 189,654,650 L1811R probably damaging Het
Cr2 A G 1: 195,171,041 I43T possibly damaging Het
Cspg4 T A 9: 56,888,629 L1216Q possibly damaging Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Cylc2 A T 4: 51,229,840 D394V unknown Het
Dcaf8 T C 1: 172,179,893 probably benign Het
Dlec1 A T 9: 119,128,078 I796F probably damaging Het
Dnah12 A T 14: 26,773,014 Q1343L probably damaging Het
Dnajc21 T C 15: 10,447,097 R522G probably benign Het
F2rl3 C T 8: 72,762,583 A146V probably benign Het
Fastkd1 C T 2: 69,712,311 E51K probably damaging Het
Glrb T C 3: 80,879,686 S57G probably damaging Het
Gm10093 A T 17: 78,492,959 T460S probably benign Het
Gm4737 C T 16: 46,153,967 C349Y possibly damaging Het
Gm5507 T A 18: 53,984,337 noncoding transcript Het
Golga4 A G 9: 118,556,845 K22E probably damaging Het
Ift122 T A 6: 115,890,588 L433Q probably damaging Het
Il21r A G 7: 125,628,899 R181G probably damaging Het
Il5ra G T 6: 106,738,498 S125* probably null Het
Kdm7a T C 6: 39,175,472 R97G probably benign Het
Lepr T A 4: 101,814,641 I954N probably benign Het
Lims1 T C 10: 58,418,790 probably benign Het
Maats1 C T 16: 38,335,523 V113I probably benign Het
Mest T C 6: 30,740,680 W13R probably damaging Het
Mfn2 A G 4: 147,887,452 V224A probably benign Het
Muc15 T C 2: 110,737,499 S330P probably damaging Het
Ncapg T C 5: 45,671,212 F102L probably damaging Het
Nkd2 T C 13: 73,823,356 D187G probably benign Het
Nphp1 C T 2: 127,766,019 probably null Het
Olfr1129 T C 2: 87,575,186 F34S probably benign Het
Olfr378 T C 11: 73,425,186 N266D probably benign Het
Osbpl6 T C 2: 76,584,492 V409A possibly damaging Het
Pdhx A T 2: 103,073,397 L18Q probably null Het
Pear1 C T 3: 87,754,661 G469D probably damaging Het
Plec T C 15: 76,181,557 T1506A probably benign Het
Plod3 T A 5: 136,988,947 D192E possibly damaging Het
Rbks T C 5: 31,624,568 N296S probably benign Het
Sema3c G A 5: 17,694,772 V421I probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc7a8 C G 14: 54,735,790 G240A possibly damaging Het
Tmem200c A G 17: 68,842,171 D583G probably benign Het
Trpm6 A G 19: 18,832,477 Y1079C probably damaging Het
Ttn T C 2: 76,822,588 probably null Het
Vcp T C 4: 42,988,813 probably benign Het
Vmn2r78 T C 7: 86,954,603 V663A probably damaging Het
Vmn2r9 T G 5: 108,847,685 M366L probably benign Het
Wdr11 A G 7: 129,629,005 E878G probably damaging Het
Zan C G 5: 137,383,834 M5150I unknown Het
Other mutations in Olfr446
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02947:Olfr446 APN 6 42927896 missense probably benign 0.24
IGL03164:Olfr446 APN 6 42928130 nonsense probably null
PIT4519001:Olfr446 UTSW 6 42927644 missense probably damaging 1.00
R1760:Olfr446 UTSW 6 42927497 missense possibly damaging 0.90
R1883:Olfr446 UTSW 6 42927830 missense probably damaging 0.99
R1884:Olfr446 UTSW 6 42927830 missense probably damaging 0.99
R2180:Olfr446 UTSW 6 42927525 missense probably benign 0.14
R3001:Olfr446 UTSW 6 42927954 missense probably damaging 1.00
R3002:Olfr446 UTSW 6 42927954 missense probably damaging 1.00
R4435:Olfr446 UTSW 6 42928089 missense probably damaging 1.00
R4544:Olfr446 UTSW 6 42927414 missense probably damaging 1.00
R5009:Olfr446 UTSW 6 42927433 missense probably damaging 1.00
R5236:Olfr446 UTSW 6 42927781 missense probably benign 0.04
R5290:Olfr446 UTSW 6 42928038 missense probably damaging 0.98
R5297:Olfr446 UTSW 6 42927437 missense probably benign 0.17
R7371:Olfr446 UTSW 6 42927535 nonsense probably null
X0065:Olfr446 UTSW 6 42928056 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAGACATGGATCACTGAGGTCATTC -3'
(R):5'- CTCCAGCTCATGATCAGTGTG -3'

Sequencing Primer
(F):5'- CATGGATCACTGAGGTCATTCTACTG -3'
(R):5'- CAGCTCATGATCAGTGTGTATTTC -3'
Posted On2015-08-18