Incidental Mutation 'R4546:Golga4'
ID 333782
Institutional Source Beutler Lab
Gene Symbol Golga4
Ensembl Gene ENSMUSG00000038708
Gene Name golgin A4
Synonyms golgin-245, Olp-1
MMRRC Submission 041780-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4546 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 118335335-118411587 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 118385913 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 22 (K22E)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084820] [ENSMUST00000212097]
AlphaFold Q91VW5
Predicted Effect probably damaging
Transcript: ENSMUST00000084820
AA Change: K1012E

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000081880
Gene: ENSMUSG00000038708
AA Change: K1012E

DomainStartEndE-ValueType
low complexity region 10 41 N/A INTRINSIC
coiled coil region 157 241 N/A INTRINSIC
internal_repeat_1 271 299 2.93e-5 PROSPERO
low complexity region 339 351 N/A INTRINSIC
low complexity region 513 532 N/A INTRINSIC
low complexity region 547 566 N/A INTRINSIC
low complexity region 705 715 N/A INTRINSIC
low complexity region 739 755 N/A INTRINSIC
low complexity region 882 895 N/A INTRINSIC
SCOP:d1epua_ 940 1076 2e-3 SMART
low complexity region 1138 1152 N/A INTRINSIC
low complexity region 1161 1182 N/A INTRINSIC
low complexity region 1204 1228 N/A INTRINSIC
coiled coil region 1283 1496 N/A INTRINSIC
internal_repeat_2 1500 1525 5.98e-5 PROSPERO
coiled coil region 1541 1715 N/A INTRINSIC
low complexity region 1756 1778 N/A INTRINSIC
internal_repeat_1 1811 1839 2.93e-5 PROSPERO
coiled coil region 1844 1883 N/A INTRINSIC
internal_repeat_2 1899 1924 5.98e-5 PROSPERO
coiled coil region 1933 2160 N/A INTRINSIC
Grip 2181 2225 1.38e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000211840
AA Change: K22E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000212097
Predicted Effect probably benign
Transcript: ENSMUST00000212183
Predicted Effect probably benign
Transcript: ENSMUST00000212274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212913
Meta Mutation Damage Score 0.0684 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein has been postulated to play a role in Rab6-regulated membrane-tethering events in the Golgi apparatus. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
Allele List at MGI

All alleles(32) : Gene trapped(32)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik G A 14: 70,393,927 (GRCm39) S236L probably benign Het
Ahcyl C T 16: 45,974,330 (GRCm39) C349Y possibly damaging Het
Alg9 C T 9: 50,716,654 (GRCm39) T409M possibly damaging Het
Alpi T A 1: 87,026,839 (GRCm39) Y413F probably damaging Het
Asmt T C X: 169,110,230 (GRCm39) probably null Het
Atf7 A G 15: 102,442,762 (GRCm39) V449A probably benign Het
Bnc2 A G 4: 84,210,213 (GRCm39) F744L probably benign Het
Ccnyl1 G T 1: 64,762,735 (GRCm39) M347I probably benign Het
Cdk13 T C 13: 17,941,159 (GRCm39) K21R probably damaging Het
Cenpf A C 1: 189,386,847 (GRCm39) L1811R probably damaging Het
Cfap91 C T 16: 38,155,885 (GRCm39) V113I probably benign Het
Cr2 A G 1: 194,853,349 (GRCm39) I43T possibly damaging Het
Cspg4 T A 9: 56,795,913 (GRCm39) L1216Q possibly damaging Het
Cylc2 A T 4: 51,229,840 (GRCm39) D394V unknown Het
Cylc2 C G 4: 51,229,651 (GRCm39) T331R unknown Het
Dcaf8 T C 1: 172,007,460 (GRCm39) probably benign Het
Dlec1 A T 9: 118,957,146 (GRCm39) I796F probably damaging Het
Dnah12 A T 14: 26,494,971 (GRCm39) Q1343L probably damaging Het
Dnajc21 T C 15: 10,447,183 (GRCm39) R522G probably benign Het
F2rl3 C T 8: 73,489,211 (GRCm39) A146V probably benign Het
Fastkd1 C T 2: 69,542,655 (GRCm39) E51K probably damaging Het
Glrb T C 3: 80,786,993 (GRCm39) S57G probably damaging Het
Gm5507 T A 18: 54,117,409 (GRCm39) noncoding transcript Het
Hdac1-ps A T 17: 78,800,388 (GRCm39) T460S probably benign Het
Ift122 T A 6: 115,867,549 (GRCm39) L433Q probably damaging Het
Il21r A G 7: 125,228,071 (GRCm39) R181G probably damaging Het
Il5ra G T 6: 106,715,459 (GRCm39) S125* probably null Het
Kdm7a T C 6: 39,152,406 (GRCm39) R97G probably benign Het
Lepr T A 4: 101,671,838 (GRCm39) I954N probably benign Het
Lims1 T C 10: 58,254,612 (GRCm39) probably benign Het
Mest T C 6: 30,740,679 (GRCm39) W13R probably damaging Het
Mfn2 A G 4: 147,971,909 (GRCm39) V224A probably benign Het
Muc15 T C 2: 110,567,844 (GRCm39) S330P probably damaging Het
Ncapg T C 5: 45,828,554 (GRCm39) F102L probably damaging Het
Nkd2 T C 13: 73,971,475 (GRCm39) D187G probably benign Het
Nphp1 C T 2: 127,607,939 (GRCm39) probably null Het
Or10ag59 T C 2: 87,405,530 (GRCm39) F34S probably benign Het
Or1e19 T C 11: 73,316,012 (GRCm39) N266D probably benign Het
Or2a12 C T 6: 42,904,348 (GRCm39) S61L probably damaging Het
Osbpl6 T C 2: 76,414,836 (GRCm39) V409A possibly damaging Het
Pdhx A T 2: 102,903,742 (GRCm39) L18Q probably null Het
Pear1 C T 3: 87,661,968 (GRCm39) G469D probably damaging Het
Plec T C 15: 76,065,757 (GRCm39) T1506A probably benign Het
Plod3 T A 5: 137,017,801 (GRCm39) D192E possibly damaging Het
Rbks T C 5: 31,781,912 (GRCm39) N296S probably benign Het
Sema3c G A 5: 17,899,770 (GRCm39) V421I probably benign Het
Slc15a4 A G 5: 127,681,600 (GRCm39) probably null Het
Slc7a8 C G 14: 54,973,247 (GRCm39) G240A possibly damaging Het
Tmem200c A G 17: 69,149,166 (GRCm39) D583G probably benign Het
Trpm6 A G 19: 18,809,841 (GRCm39) Y1079C probably damaging Het
Ttn T C 2: 76,652,932 (GRCm39) probably null Het
Vcp T C 4: 42,988,813 (GRCm39) probably benign Het
Vmn2r78 T C 7: 86,603,811 (GRCm39) V663A probably damaging Het
Vmn2r9 T G 5: 108,995,551 (GRCm39) M366L probably benign Het
Wdr11 A G 7: 129,230,729 (GRCm39) E878G probably damaging Het
Zan C G 5: 137,382,096 (GRCm39) M5150I unknown Het
Other mutations in Golga4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00711:Golga4 APN 9 118,343,339 (GRCm39) critical splice donor site probably null
IGL00801:Golga4 APN 9 118,367,994 (GRCm39) missense probably damaging 0.98
IGL01395:Golga4 APN 9 118,364,441 (GRCm39) missense probably damaging 1.00
IGL01472:Golga4 APN 9 118,361,642 (GRCm39) missense probably damaging 1.00
IGL01519:Golga4 APN 9 118,356,160 (GRCm39) missense probably damaging 1.00
IGL01563:Golga4 APN 9 118,356,074 (GRCm39) splice site probably benign
IGL02593:Golga4 APN 9 118,384,634 (GRCm39) unclassified probably benign
IGL02803:Golga4 APN 9 118,364,528 (GRCm39) missense probably benign
IGL02939:Golga4 APN 9 118,363,700 (GRCm39) missense probably damaging 1.00
IGL02939:Golga4 APN 9 118,364,522 (GRCm39) missense probably benign 0.01
IGL03123:Golga4 APN 9 118,365,953 (GRCm39) missense probably damaging 1.00
IGL03334:Golga4 APN 9 118,366,301 (GRCm39) splice site probably benign
F5770:Golga4 UTSW 9 118,385,143 (GRCm39) missense possibly damaging 0.62
F6893:Golga4 UTSW 9 118,382,525 (GRCm39) missense probably damaging 1.00
PIT4382001:Golga4 UTSW 9 118,382,521 (GRCm39) missense possibly damaging 0.88
R0179:Golga4 UTSW 9 118,389,808 (GRCm39) critical splice acceptor site probably null
R0279:Golga4 UTSW 9 118,398,061 (GRCm39) missense probably benign 0.00
R0362:Golga4 UTSW 9 118,384,853 (GRCm39) missense probably benign 0.13
R0973:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R0973:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R0974:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R1128:Golga4 UTSW 9 118,377,852 (GRCm39) missense probably benign 0.40
R1384:Golga4 UTSW 9 118,394,719 (GRCm39) missense probably damaging 0.99
R1435:Golga4 UTSW 9 118,364,508 (GRCm39) missense probably benign 0.00
R1513:Golga4 UTSW 9 118,384,800 (GRCm39) missense probably benign 0.02
R1818:Golga4 UTSW 9 118,402,055 (GRCm39) missense probably damaging 1.00
R2083:Golga4 UTSW 9 118,361,658 (GRCm39) missense probably damaging 1.00
R2243:Golga4 UTSW 9 118,385,972 (GRCm39) missense probably benign 0.06
R2355:Golga4 UTSW 9 118,389,810 (GRCm39) missense probably benign 0.00
R2518:Golga4 UTSW 9 118,385,680 (GRCm39) missense probably damaging 1.00
R2921:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R2922:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R2923:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R3121:Golga4 UTSW 9 118,386,448 (GRCm39) missense possibly damaging 0.68
R3424:Golga4 UTSW 9 118,363,715 (GRCm39) missense probably benign 0.16
R3909:Golga4 UTSW 9 118,387,804 (GRCm39) missense possibly damaging 0.82
R3913:Golga4 UTSW 9 118,368,039 (GRCm39) missense probably damaging 0.99
R4321:Golga4 UTSW 9 118,385,503 (GRCm39) missense probably damaging 1.00
R4358:Golga4 UTSW 9 118,380,946 (GRCm39) missense probably benign 0.16
R4483:Golga4 UTSW 9 118,343,254 (GRCm39) missense probably damaging 1.00
R4515:Golga4 UTSW 9 118,388,076 (GRCm39) missense probably benign 0.28
R4518:Golga4 UTSW 9 118,388,076 (GRCm39) missense probably benign 0.28
R4519:Golga4 UTSW 9 118,388,076 (GRCm39) missense probably benign 0.28
R4545:Golga4 UTSW 9 118,385,913 (GRCm39) missense probably damaging 1.00
R4580:Golga4 UTSW 9 118,386,327 (GRCm39) missense probably benign 0.00
R4918:Golga4 UTSW 9 118,387,213 (GRCm39) missense probably damaging 1.00
R5007:Golga4 UTSW 9 118,387,368 (GRCm39) missense probably benign
R5045:Golga4 UTSW 9 118,394,724 (GRCm39) missense probably benign
R5232:Golga4 UTSW 9 118,335,626 (GRCm39) critical splice donor site probably null
R5256:Golga4 UTSW 9 118,385,569 (GRCm39) missense possibly damaging 0.93
R5502:Golga4 UTSW 9 118,388,125 (GRCm39) nonsense probably null
R5567:Golga4 UTSW 9 118,387,251 (GRCm39) missense probably damaging 1.00
R5576:Golga4 UTSW 9 118,382,602 (GRCm39) missense probably benign 0.13
R5771:Golga4 UTSW 9 118,387,351 (GRCm39) missense probably damaging 0.96
R5807:Golga4 UTSW 9 118,356,198 (GRCm39) missense probably damaging 0.99
R5860:Golga4 UTSW 9 118,387,174 (GRCm39) missense probably damaging 1.00
R6012:Golga4 UTSW 9 118,388,764 (GRCm39) missense possibly damaging 0.90
R6285:Golga4 UTSW 9 118,387,695 (GRCm39) nonsense probably null
R6299:Golga4 UTSW 9 118,386,438 (GRCm39) missense probably benign 0.03
R6467:Golga4 UTSW 9 118,365,860 (GRCm39) missense probably damaging 1.00
R6552:Golga4 UTSW 9 118,343,299 (GRCm39) missense probably damaging 1.00
R6688:Golga4 UTSW 9 118,343,278 (GRCm39) missense possibly damaging 0.66
R6965:Golga4 UTSW 9 118,377,847 (GRCm39) missense probably damaging 1.00
R6987:Golga4 UTSW 9 118,387,600 (GRCm39) missense probably benign
R7212:Golga4 UTSW 9 118,365,908 (GRCm39) missense possibly damaging 0.80
R7426:Golga4 UTSW 9 118,388,563 (GRCm39) missense probably benign
R7431:Golga4 UTSW 9 118,388,799 (GRCm39) missense probably damaging 1.00
R7641:Golga4 UTSW 9 118,386,643 (GRCm39) missense probably benign 0.05
R7727:Golga4 UTSW 9 118,377,770 (GRCm39) missense probably damaging 1.00
R7729:Golga4 UTSW 9 118,385,131 (GRCm39) missense possibly damaging 0.51
R7811:Golga4 UTSW 9 118,361,643 (GRCm39) missense probably damaging 1.00
R7849:Golga4 UTSW 9 118,388,379 (GRCm39) missense possibly damaging 0.93
R7891:Golga4 UTSW 9 118,385,434 (GRCm39) missense probably damaging 1.00
R7976:Golga4 UTSW 9 118,365,836 (GRCm39) missense possibly damaging 0.49
R8275:Golga4 UTSW 9 118,361,627 (GRCm39) missense probably damaging 1.00
R8378:Golga4 UTSW 9 118,387,390 (GRCm39) missense probably benign 0.03
R8514:Golga4 UTSW 9 118,384,864 (GRCm39) missense possibly damaging 0.47
R8698:Golga4 UTSW 9 118,385,029 (GRCm39) missense probably damaging 0.97
R8856:Golga4 UTSW 9 118,385,779 (GRCm39) missense probably damaging 0.98
R9227:Golga4 UTSW 9 118,385,941 (GRCm39) missense possibly damaging 0.94
R9282:Golga4 UTSW 9 118,385,893 (GRCm39) missense probably damaging 1.00
RF022:Golga4 UTSW 9 118,387,057 (GRCm39) missense probably damaging 1.00
V7583:Golga4 UTSW 9 118,385,143 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GGCCAAGGAAATCGAGATCC -3'
(R):5'- TCTGCAGCTTGCTGACTCAG -3'

Sequencing Primer
(F):5'- GAGATCCTCAAACAGACATTGTCTTC -3'
(R):5'- GACTCAGCTTCTTTTCCCAGG -3'
Posted On 2015-08-18