Incidental Mutation 'R0207:Mthfr'
ID33379
Institutional Source Beutler Lab
Gene Symbol Mthfr
Ensembl Gene ENSMUSG00000029009
Gene Namemethylenetetrahydrofolate reductase
Synonyms
MMRRC Submission 038460-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.782) question?
Stock #R0207 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location148039077-148059551 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 148052224 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 446 (V446G)
Ref Sequence ENSEMBL: ENSMUSP00000117095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069604] [ENSMUST00000097788] [ENSMUST00000152498]
Predicted Effect probably damaging
Transcript: ENSMUST00000069604
AA Change: V471G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069774
Gene: ENSMUSG00000029009
AA Change: V471G

DomainStartEndE-ValueType
low complexity region 48 73 N/A INTRINSIC
Pfam:MTHFR 88 377 2.3e-121 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097788
AA Change: V430G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095395
Gene: ENSMUSG00000029009
AA Change: V430G

DomainStartEndE-ValueType
low complexity region 7 32 N/A INTRINSIC
Pfam:MTHFR 47 336 5.9e-121 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000152498
AA Change: V446G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117095
Gene: ENSMUSG00000029009
AA Change: V446G

DomainStartEndE-ValueType
low complexity region 23 48 N/A INTRINSIC
Pfam:MTHFR 63 352 2.4e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156113
Meta Mutation Damage Score 0.9289 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.5%
Validation Efficiency 95% (76/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the conversion of 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofolate, a co-substrate for homocysteine remethylation to methionine. Genetic variation in this gene influences susceptibility to occlusive vascular disease, neural tube defects, colon cancer and acute leukemia, and mutations in this gene are associated with methylenetetrahydrofolate reductase deficiency.[provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene have elevated plasma levels of homocysteine. They also display delayed growth and development and a reduced survival rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,086,039 F488S probably damaging Het
Acap3 C T 4: 155,899,424 R116W probably damaging Het
Adamts10 C A 17: 33,545,390 P663T possibly damaging Het
Akap12 G A 10: 4,353,333 G48S probably damaging Het
Ankrd7 T A 6: 18,870,031 M261K probably benign Het
Ankzf1 C A 1: 75,198,304 D599E possibly damaging Het
Aox1 T C 1: 58,105,014 I1278T possibly damaging Het
Apcdd1 T C 18: 62,950,079 Y327H probably benign Het
Asxl3 T A 18: 22,411,496 probably benign Het
Birc6 C A 17: 74,662,832 probably benign Het
Btaf1 T A 19: 37,009,648 L1714* probably null Het
Cacng6 T A 7: 3,425,004 probably benign Het
Cdc20b A G 13: 113,078,612 D238G probably damaging Het
Celf5 T A 10: 81,470,698 R113W probably null Het
Cfap70 C A 14: 20,412,347 E659D probably damaging Het
Clspn T A 4: 126,590,598 M1183K possibly damaging Het
Dpy19l1 G A 9: 24,453,891 R275C probably damaging Het
Dst C T 1: 34,186,935 S1721L probably benign Het
Faap100 T C 11: 120,374,365 T562A probably damaging Het
Fam168b T C 1: 34,819,688 M133V probably damaging Het
Farp2 T C 1: 93,569,087 I172T probably damaging Het
Fer T G 17: 63,896,278 S68A probably damaging Het
Fmo5 A G 3: 97,645,681 E315G probably damaging Het
Gpr89 A T 3: 96,871,480 F426I probably damaging Het
Hinfp T C 9: 44,296,327 I461V possibly damaging Het
Hsd11b1 A T 1: 193,240,248 V167D probably damaging Het
Htt A G 5: 34,896,908 K2574E probably benign Het
I830077J02Rik A G 3: 105,926,505 S112P probably benign Het
Igf2bp3 T A 6: 49,105,617 M344L probably benign Het
Itch A T 2: 155,202,257 Q494L probably benign Het
Itga9 T C 9: 118,769,253 probably benign Het
Jaml T A 9: 45,093,767 D152E probably benign Het
Kif22 A C 7: 127,042,400 M1R probably null Het
Kifap3 T C 1: 163,883,386 Y663H probably benign Het
Letm2 T A 8: 25,578,770 N472I probably damaging Het
Myh11 T C 16: 14,211,260 E1206G possibly damaging Het
Myo6 G A 9: 80,288,056 V903I probably damaging Het
Myo9b C T 8: 71,355,225 probably benign Het
Nr2f2 G C 7: 70,360,175 P52R probably damaging Het
Nsd3 A G 8: 25,683,257 N859S probably benign Het
Nucb2 C A 7: 116,536,010 A384E probably damaging Het
Ogdhl C A 14: 32,342,037 probably null Het
Olfr119 C A 17: 37,701,058 C129* probably null Het
Olfr1247 G A 2: 89,609,863 L80F probably damaging Het
Olfr1357 T C 10: 78,611,871 T257A probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr381 A T 11: 73,486,575 L83Q probably benign Het
Parp10 C T 15: 76,242,633 S145N probably benign Het
Pigh A G 12: 79,083,709 probably benign Het
Pigo A G 4: 43,023,824 probably benign Het
Pkp4 T A 2: 59,305,488 V199D possibly damaging Het
Polr1e C A 4: 45,025,143 probably null Het
Ppfia3 C A 7: 45,348,534 R723L probably damaging Het
Prex1 C A 2: 166,585,898 A945S possibly damaging Het
Prrt3 A T 6: 113,495,840 V457E probably damaging Het
Rab39 A G 9: 53,705,971 F49L possibly damaging Het
Rrs1 C A 1: 9,545,762 probably null Het
Rrs1 G A 1: 9,545,767 E82K probably damaging Het
Serpinb3c T C 1: 107,276,992 D8G probably benign Het
Slc17a6 A G 7: 51,646,180 probably benign Het
Slc24a4 T A 12: 102,228,951 probably null Het
Smc1b C T 15: 85,123,759 M272I probably benign Het
Smc6 T C 12: 11,283,178 probably benign Het
Tcf20 T C 15: 82,855,085 T722A probably benign Het
Tesmin A T 19: 3,404,088 M141L probably benign Het
Tmprss5 T A 9: 49,113,160 H274Q possibly damaging Het
Tns1 C T 1: 73,937,318 probably null Het
Tpr T C 1: 150,417,427 S868P possibly damaging Het
Trank1 C T 9: 111,366,253 T1115I probably damaging Het
Trmt44 A T 5: 35,572,917 I203K possibly damaging Het
Ulk2 A T 11: 61,777,785 V1037E probably benign Het
Usp43 A G 11: 67,876,499 Y682H probably damaging Het
Vipr2 A T 12: 116,142,882 Q366L probably damaging Het
Vmn1r185 C A 7: 26,611,589 V164L possibly damaging Het
Vmn2r120 C T 17: 57,525,052 V246I probably benign Het
Wdr66 T C 5: 123,283,447 V182A probably damaging Het
Wiz C T 17: 32,357,033 G790R probably damaging Het
Wnk1 A T 6: 119,952,733 S1016R probably damaging Het
Zc3hav1 A G 6: 38,311,174 L909S probably benign Het
Zfp236 T A 18: 82,640,227 I637F probably damaging Het
Zfp788 G A 7: 41,649,596 G532D probably damaging Het
Zranb1 T C 7: 132,950,385 I255T probably damaging Het
Other mutations in Mthfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Mthfr APN 4 148041270 missense probably benign
IGL00911:Mthfr APN 4 148041302 missense probably benign 0.01
R0116:Mthfr UTSW 4 148051523 missense probably benign 0.00
R0268:Mthfr UTSW 4 148055428 missense probably damaging 1.00
R0344:Mthfr UTSW 4 148055428 missense probably damaging 1.00
R0762:Mthfr UTSW 4 148055443 missense possibly damaging 0.65
R1433:Mthfr UTSW 4 148055443 missense possibly damaging 0.92
R1464:Mthfr UTSW 4 148053572 splice site probably benign
R1972:Mthfr UTSW 4 148051927 missense probably damaging 1.00
R3154:Mthfr UTSW 4 148051604 missense probably benign 0.12
R3407:Mthfr UTSW 4 148055061 missense probably damaging 1.00
R3773:Mthfr UTSW 4 148044450 missense probably benign 0.00
R4153:Mthfr UTSW 4 148051475 missense probably damaging 0.99
R4291:Mthfr UTSW 4 148055492 missense probably damaging 1.00
R4487:Mthfr UTSW 4 148051427 missense probably benign 0.00
R4574:Mthfr UTSW 4 148043541 missense possibly damaging 0.95
R4583:Mthfr UTSW 4 148051872 missense possibly damaging 0.80
R4847:Mthfr UTSW 4 148048139 missense probably damaging 0.99
R5183:Mthfr UTSW 4 148051360 splice site probably null
R5536:Mthfr UTSW 4 148044483 missense probably damaging 1.00
R5664:Mthfr UTSW 4 148055466 missense probably damaging 1.00
R6161:Mthfr UTSW 4 148041754 missense probably benign 0.35
R7285:Mthfr UTSW 4 148053599 missense probably benign 0.01
R7427:Mthfr UTSW 4 148051603 missense probably benign 0.00
R7428:Mthfr UTSW 4 148051603 missense probably benign 0.00
R7474:Mthfr UTSW 4 148052602 missense possibly damaging 0.95
R7823:Mthfr UTSW 4 148051487 missense probably benign 0.29
R7826:Mthfr UTSW 4 148055010 missense probably benign 0.00
R7975:Mthfr UTSW 4 148043463 missense probably damaging 1.00
R8669:Mthfr UTSW 4 148051477 missense probably benign 0.21
R8698:Mthfr UTSW 4 148044490 nonsense probably null
R8714:Mthfr UTSW 4 148041818 missense probably damaging 1.00
R8790:Mthfr UTSW 4 148055534 missense probably benign 0.07
R8961:Mthfr UTSW 4 148043642 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACATCTACCGCACACAGGACTGG -3'
(R):5'- AGGCGCACATCTCATATAGGGGAG -3'

Sequencing Primer
(F):5'- CAGGACTGGGATGAGTTTCCTAAC -3'
(R):5'- CACATCTCATATAGGGGAGATAGCTC -3'
Posted On2013-05-09