Incidental Mutation 'R4546:Atf7'
ID333792
Institutional Source Beutler Lab
Gene Symbol Atf7
Ensembl Gene ENSMUSG00000099083
Gene Nameactivating transcription factor 7
Synonyms
MMRRC Submission 041780-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4546 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location102525946-102625464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102534327 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 449 (V449A)
Ref Sequence ENSEMBL: ENSMUSP00000139181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108828] [ENSMUST00000169033] [ENSMUST00000184485] [ENSMUST00000184616] [ENSMUST00000184772] [ENSMUST00000184906]
Predicted Effect probably benign
Transcript: ENSMUST00000108828
SMART Domains Protein: ENSMUSP00000104456
Gene: ENSMUSG00000099083

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
low complexity region 108 130 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 300 318 N/A INTRINSIC
low complexity region 319 326 N/A INTRINSIC
BRLZ 330 394 3.46e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169033
SMART Domains Protein: ENSMUSP00000130130
Gene: ENSMUSG00000099083

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
low complexity region 108 130 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 300 318 N/A INTRINSIC
low complexity region 319 326 N/A INTRINSIC
BRLZ 330 394 3.46e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184485
AA Change: V449A

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000139308
Gene: ENSMUSG00000099083
AA Change: V449A

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
low complexity region 108 130 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 300 318 N/A INTRINSIC
low complexity region 319 326 N/A INTRINSIC
BRLZ 330 394 3.46e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184616
AA Change: V449A

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000139181
Gene: ENSMUSG00000099083
AA Change: V449A

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
low complexity region 108 130 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 300 318 N/A INTRINSIC
low complexity region 319 326 N/A INTRINSIC
BRLZ 330 394 3.46e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184772
SMART Domains Protein: ENSMUSP00000138975
Gene: ENSMUSG00000052414

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
low complexity region 108 130 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 300 318 N/A INTRINSIC
low complexity region 319 326 N/A INTRINSIC
BRLZ 330 394 3.46e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184906
SMART Domains Protein: ENSMUSP00000139243
Gene: ENSMUSG00000099083

DomainStartEndE-ValueType
ZnF_C2H2 7 31 6.32e-3 SMART
low complexity region 108 130 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 300 318 N/A INTRINSIC
low complexity region 319 326 N/A INTRINSIC
BRLZ 330 394 3.46e-18 SMART
Meta Mutation Damage Score 0.0732 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (65/67)
MGI Phenotype PHENOTYPE: Mice homozygous for one knock-out allele exhibit increased marble burying, increased startle response, and decreased prepulse inhibition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik G A 14: 70,156,478 S236L probably benign Het
Alg9 C T 9: 50,805,354 T409M possibly damaging Het
Alpi T A 1: 87,099,117 Y413F probably damaging Het
Asmt T C X: 170,676,495 probably null Het
Bnc2 A G 4: 84,291,976 F744L probably benign Het
Ccnyl1 G T 1: 64,723,576 M347I probably benign Het
Cdk13 T C 13: 17,766,574 K21R probably damaging Het
Cenpf A C 1: 189,654,650 L1811R probably damaging Het
Cr2 A G 1: 195,171,041 I43T possibly damaging Het
Cspg4 T A 9: 56,888,629 L1216Q possibly damaging Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Cylc2 A T 4: 51,229,840 D394V unknown Het
Dcaf8 T C 1: 172,179,893 probably benign Het
Dlec1 A T 9: 119,128,078 I796F probably damaging Het
Dnah12 A T 14: 26,773,014 Q1343L probably damaging Het
Dnajc21 T C 15: 10,447,097 R522G probably benign Het
F2rl3 C T 8: 72,762,583 A146V probably benign Het
Fastkd1 C T 2: 69,712,311 E51K probably damaging Het
Glrb T C 3: 80,879,686 S57G probably damaging Het
Gm10093 A T 17: 78,492,959 T460S probably benign Het
Gm4737 C T 16: 46,153,967 C349Y possibly damaging Het
Gm5507 T A 18: 53,984,337 noncoding transcript Het
Golga4 A G 9: 118,556,845 K22E probably damaging Het
Ift122 T A 6: 115,890,588 L433Q probably damaging Het
Il21r A G 7: 125,628,899 R181G probably damaging Het
Il5ra G T 6: 106,738,498 S125* probably null Het
Kdm7a T C 6: 39,175,472 R97G probably benign Het
Lepr T A 4: 101,814,641 I954N probably benign Het
Lims1 T C 10: 58,418,790 probably benign Het
Maats1 C T 16: 38,335,523 V113I probably benign Het
Mest T C 6: 30,740,680 W13R probably damaging Het
Mfn2 A G 4: 147,887,452 V224A probably benign Het
Muc15 T C 2: 110,737,499 S330P probably damaging Het
Ncapg T C 5: 45,671,212 F102L probably damaging Het
Nkd2 T C 13: 73,823,356 D187G probably benign Het
Nphp1 C T 2: 127,766,019 probably null Het
Olfr1129 T C 2: 87,575,186 F34S probably benign Het
Olfr378 T C 11: 73,425,186 N266D probably benign Het
Olfr446 C T 6: 42,927,414 S61L probably damaging Het
Osbpl6 T C 2: 76,584,492 V409A possibly damaging Het
Pdhx A T 2: 103,073,397 L18Q probably null Het
Pear1 C T 3: 87,754,661 G469D probably damaging Het
Plec T C 15: 76,181,557 T1506A probably benign Het
Plod3 T A 5: 136,988,947 D192E possibly damaging Het
Rbks T C 5: 31,624,568 N296S probably benign Het
Sema3c G A 5: 17,694,772 V421I probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc7a8 C G 14: 54,735,790 G240A possibly damaging Het
Tmem200c A G 17: 68,842,171 D583G probably benign Het
Trpm6 A G 19: 18,832,477 Y1079C probably damaging Het
Ttn T C 2: 76,822,588 probably null Het
Vcp T C 4: 42,988,813 probably benign Het
Vmn2r78 T C 7: 86,954,603 V663A probably damaging Het
Vmn2r9 T G 5: 108,847,685 M366L probably benign Het
Wdr11 A G 7: 129,629,005 E878G probably damaging Het
Zan C G 5: 137,383,834 M5150I unknown Het
Other mutations in Atf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01914:Atf7 APN 15 102551478 nonsense probably null
R2183:Atf7 UTSW 15 102546473 missense possibly damaging 0.93
R2516:Atf7 UTSW 15 102529004 intron probably benign
R3114:Atf7 UTSW 15 102534423 missense probably benign 0.10
R3115:Atf7 UTSW 15 102534423 missense probably benign 0.10
R4544:Atf7 UTSW 15 102534327 missense probably benign 0.08
R4545:Atf7 UTSW 15 102534327 missense probably benign 0.08
R5148:Atf7 UTSW 15 102547173 missense probably benign 0.02
R5568:Atf7 UTSW 15 102563322 missense probably damaging 0.99
R5688:Atf7 UTSW 15 102551509 missense probably damaging 1.00
R5805:Atf7 UTSW 15 102557587 splice site probably null
R6021:Atf7 UTSW 15 102557473 missense probably benign 0.20
R6259:Atf7 UTSW 15 102547238 missense probably damaging 1.00
R6347:Atf7 UTSW 15 102546479 missense possibly damaging 0.91
R6476:Atf7 UTSW 15 102593712 missense probably benign 0.13
R6794:Atf7 UTSW 15 102557465 missense probably benign 0.09
R7104:Atf7 UTSW 15 102534235 missense probably benign 0.40
R7369:Atf7 UTSW 15 102553809 missense probably damaging 0.98
R8111:Atf7 UTSW 15 102563334 missense probably damaging 0.96
R8244:Atf7 UTSW 15 102528866 missense unknown
X0027:Atf7 UTSW 15 102593670 critical splice donor site probably null
Z1088:Atf7 UTSW 15 102547182 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCATTCTGCCCAATTCCAAG -3'
(R):5'- TGACAAAGAAGAGTCCTTTCTGTTC -3'

Sequencing Primer
(F):5'- ACAGGAGGGGTTAAGTTGATCTCTC -3'
(R):5'- AAAGAAGAGTCCTTTCTGTTCCTCTG -3'
Posted On2015-08-18