Incidental Mutation 'R4546:Gm10093'
ID333796
Institutional Source Beutler Lab
Gene Symbol Gm10093
Ensembl Gene ENSMUSG00000061062
Gene Namepredicted pseudogene 10093
SynonymsEG15181
MMRRC Submission 041780-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.796) question?
Stock #R4546 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location78491565-78493541 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78492959 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 460 (T460S)
Ref Sequence ENSEMBL: ENSMUSP00000078339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079363]
Predicted Effect probably benign
Transcript: ENSMUST00000079363
AA Change: T460S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000078339
Gene: ENSMUSG00000061062
AA Change: T460S

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 18 320 3.2e-84 PFAM
low complexity region 390 402 N/A INTRINSIC
low complexity region 417 430 N/A INTRINSIC
low complexity region 443 471 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (65/67)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik G A 14: 70,156,478 S236L probably benign Het
Alg9 C T 9: 50,805,354 T409M possibly damaging Het
Alpi T A 1: 87,099,117 Y413F probably damaging Het
Asmt T C X: 170,676,495 probably null Het
Atf7 A G 15: 102,534,327 V449A probably benign Het
Bnc2 A G 4: 84,291,976 F744L probably benign Het
Ccnyl1 G T 1: 64,723,576 M347I probably benign Het
Cdk13 T C 13: 17,766,574 K21R probably damaging Het
Cenpf A C 1: 189,654,650 L1811R probably damaging Het
Cr2 A G 1: 195,171,041 I43T possibly damaging Het
Cspg4 T A 9: 56,888,629 L1216Q possibly damaging Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Cylc2 A T 4: 51,229,840 D394V unknown Het
Dcaf8 T C 1: 172,179,893 probably benign Het
Dlec1 A T 9: 119,128,078 I796F probably damaging Het
Dnah12 A T 14: 26,773,014 Q1343L probably damaging Het
Dnajc21 T C 15: 10,447,097 R522G probably benign Het
F2rl3 C T 8: 72,762,583 A146V probably benign Het
Fastkd1 C T 2: 69,712,311 E51K probably damaging Het
Glrb T C 3: 80,879,686 S57G probably damaging Het
Gm4737 C T 16: 46,153,967 C349Y possibly damaging Het
Gm5507 T A 18: 53,984,337 noncoding transcript Het
Golga4 A G 9: 118,556,845 K22E probably damaging Het
Ift122 T A 6: 115,890,588 L433Q probably damaging Het
Il21r A G 7: 125,628,899 R181G probably damaging Het
Il5ra G T 6: 106,738,498 S125* probably null Het
Kdm7a T C 6: 39,175,472 R97G probably benign Het
Lepr T A 4: 101,814,641 I954N probably benign Het
Lims1 T C 10: 58,418,790 probably benign Het
Maats1 C T 16: 38,335,523 V113I probably benign Het
Mest T C 6: 30,740,680 W13R probably damaging Het
Mfn2 A G 4: 147,887,452 V224A probably benign Het
Muc15 T C 2: 110,737,499 S330P probably damaging Het
Ncapg T C 5: 45,671,212 F102L probably damaging Het
Nkd2 T C 13: 73,823,356 D187G probably benign Het
Nphp1 C T 2: 127,766,019 probably null Het
Olfr1129 T C 2: 87,575,186 F34S probably benign Het
Olfr378 T C 11: 73,425,186 N266D probably benign Het
Olfr446 C T 6: 42,927,414 S61L probably damaging Het
Osbpl6 T C 2: 76,584,492 V409A possibly damaging Het
Pdhx A T 2: 103,073,397 L18Q probably null Het
Pear1 C T 3: 87,754,661 G469D probably damaging Het
Plec T C 15: 76,181,557 T1506A probably benign Het
Plod3 T A 5: 136,988,947 D192E possibly damaging Het
Rbks T C 5: 31,624,568 N296S probably benign Het
Sema3c G A 5: 17,694,772 V421I probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc7a8 C G 14: 54,735,790 G240A possibly damaging Het
Tmem200c A G 17: 68,842,171 D583G probably benign Het
Trpm6 A G 19: 18,832,477 Y1079C probably damaging Het
Ttn T C 2: 76,822,588 probably null Het
Vcp T C 4: 42,988,813 probably benign Het
Vmn2r78 T C 7: 86,954,603 V663A probably damaging Het
Vmn2r9 T G 5: 108,847,685 M366L probably benign Het
Wdr11 A G 7: 129,629,005 E878G probably damaging Het
Zan C G 5: 137,383,834 M5150I unknown Het
Other mutations in Gm10093
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01936:Gm10093 APN 17 78492129 missense probably damaging 1.00
IGL01983:Gm10093 APN 17 78492853 missense probably benign
IGL02543:Gm10093 APN 17 78491874 missense probably damaging 0.97
R1174:Gm10093 UTSW 17 78492078 missense probably benign 0.01
R1605:Gm10093 UTSW 17 78492108 missense probably damaging 0.98
R2416:Gm10093 UTSW 17 78492516 missense probably damaging 1.00
R2919:Gm10093 UTSW 17 78492846 missense probably damaging 0.98
R2920:Gm10093 UTSW 17 78492846 missense probably damaging 0.98
R3846:Gm10093 UTSW 17 78492972 missense possibly damaging 0.91
R4544:Gm10093 UTSW 17 78492959 missense probably benign 0.02
R5223:Gm10093 UTSW 17 78492438 missense probably benign 0.02
R5297:Gm10093 UTSW 17 78492758 missense probably benign
R6164:Gm10093 UTSW 17 78492287 missense probably damaging 0.99
R6568:Gm10093 UTSW 17 78492588 missense probably damaging 1.00
R6726:Gm10093 UTSW 17 78492858 missense probably damaging 0.99
R6901:Gm10093 UTSW 17 78492660 missense probably benign 0.07
R6923:Gm10093 UTSW 17 78492914 missense possibly damaging 0.91
R7838:Gm10093 UTSW 17 78492018 missense probably damaging 1.00
R8002:Gm10093 UTSW 17 78492287 missense probably damaging 0.99
X0060:Gm10093 UTSW 17 78492128 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGACAAACGCATCTCCATCTGC -3'
(R):5'- TTCTTTCCACGCAAATGGGG -3'

Sequencing Primer
(F):5'- GCTCCTCTGACAAACGCATTG -3'
(R):5'- ATGGACAAGGTCGCTCTGG -3'
Posted On2015-08-18