Mutagenetix > Incidental Mutation

Incidental Mutation 'R4546:Trpm6'

333798

Institutional Source

Beutler Lab

Gene Symbol

Trpm6

Ensembl Gene

ENSMUSG00000024727

Gene Name

transient receptor potential cation channel, subfamily M, member 6

Synonyms

CHAK2

MMRRC Submission

041780-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4546 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

18749983-18892510 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 18832477 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 1079 (Y1079C)

Ref Sequence

ENSEMBL: ENSMUSP00000037443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040489]

AlphaFold

Q8CIR4

Predicted Effect

probably damaging
Transcript: ENSMUST00000040489
AA Change: Y1079C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000037443
Gene: ENSMUSG00000024727
AA Change: Y1079C

Domain	Start	End	E-Value	Type
Blast:ANK	430	459	4e-8	BLAST
low complexity region	580	604	N/A	INTRINSIC
transmembrane domain	749	766	N/A	INTRINSIC
Pfam:Ion_trans	847	1087	2.8e-13	PFAM
low complexity region	1113	1126	N/A	INTRINSIC
low complexity region	1136	1154	N/A	INTRINSIC
Pfam:TRPM_tetra	1176	1231	7.5e-27	PFAM
low complexity region	1320	1331	N/A	INTRINSIC
low complexity region	1578	1596	N/A	INTRINSIC
Blast:Alpha_kinase	1618	1673	9e-11	BLAST
low complexity region	1682	1695	N/A	INTRINSIC
Alpha_kinase	1761	1978	1e-84	SMART

Meta Mutation Damage Score

0.8482

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

97% (65/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predominantly expressed in the kidney and colon, and encodes a protein containing an ion channel domain and a protein kinase domain. It is crucial for magnesium homeostasis, and plays an essential role in epithelial magnesium transport and in the active magnesium absorption in the gut and kidney. Mutations in this gene are associated with hypomagnesemia with secondary hypocalcemia. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic and postnatal lethality with exencephaly, spina bifida occulta, and abnormal brain and facial development. Mice heterozygous for a knock-out allele exhibit some premature death and decreased serummagnesium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930012K11Rik	G	A	14: 70,156,478	S236L	probably benign	Het
Alg9	C	T	9: 50,805,354	T409M	possibly damaging	Het
Alpi	T	A	1: 87,099,117	Y413F	probably damaging	Het
Asmt	T	C	X: 170,676,495		probably null	Het
Atf7	A	G	15: 102,534,327	V449A	probably benign	Het
Bnc2	A	G	4: 84,291,976	F744L	probably benign	Het
Ccnyl1	G	T	1: 64,723,576	M347I	probably benign	Het
Cdk13	T	C	13: 17,766,574	K21R	probably damaging	Het
Cenpf	A	C	1: 189,654,650	L1811R	probably damaging	Het
Cr2	A	G	1: 195,171,041	I43T	possibly damaging	Het
Cspg4	T	A	9: 56,888,629	L1216Q	possibly damaging	Het
Cylc2	C	G	4: 51,229,651	T331R	unknown	Het
Cylc2	A	T	4: 51,229,840	D394V	unknown	Het
Dcaf8	T	C	1: 172,179,893		probably benign	Het
Dlec1	A	T	9: 119,128,078	I796F	probably damaging	Het
Dnah12	A	T	14: 26,773,014	Q1343L	probably damaging	Het
Dnajc21	T	C	15: 10,447,097	R522G	probably benign	Het
F2rl3	C	T	8: 72,762,583	A146V	probably benign	Het
Fastkd1	C	T	2: 69,712,311	E51K	probably damaging	Het
Glrb	T	C	3: 80,879,686	S57G	probably damaging	Het
Gm10093	A	T	17: 78,492,959	T460S	probably benign	Het
Gm4737	C	T	16: 46,153,967	C349Y	possibly damaging	Het
Gm5507	T	A	18: 53,984,337		noncoding transcript	Het
Golga4	A	G	9: 118,556,845	K22E	probably damaging	Het
Ift122	T	A	6: 115,890,588	L433Q	probably damaging	Het
Il21r	A	G	7: 125,628,899	R181G	probably damaging	Het
Il5ra	G	T	6: 106,738,498	S125*	probably null	Het
Kdm7a	T	C	6: 39,175,472	R97G	probably benign	Het
Lepr	T	A	4: 101,814,641	I954N	probably benign	Het
Lims1	T	C	10: 58,418,790		probably benign	Het
Maats1	C	T	16: 38,335,523	V113I	probably benign	Het
Mest	T	C	6: 30,740,680	W13R	probably damaging	Het
Mfn2	A	G	4: 147,887,452	V224A	probably benign	Het
Muc15	T	C	2: 110,737,499	S330P	probably damaging	Het
Ncapg	T	C	5: 45,671,212	F102L	probably damaging	Het
Nkd2	T	C	13: 73,823,356	D187G	probably benign	Het
Nphp1	C	T	2: 127,766,019		probably null	Het
Olfr1129	T	C	2: 87,575,186	F34S	probably benign	Het
Olfr378	T	C	11: 73,425,186	N266D	probably benign	Het
Olfr446	C	T	6: 42,927,414	S61L	probably damaging	Het
Osbpl6	T	C	2: 76,584,492	V409A	possibly damaging	Het
Pdhx	A	T	2: 103,073,397	L18Q	probably null	Het
Pear1	C	T	3: 87,754,661	G469D	probably damaging	Het
Plec	T	C	15: 76,181,557	T1506A	probably benign	Het
Plod3	T	A	5: 136,988,947	D192E	possibly damaging	Het
Rbks	T	C	5: 31,624,568	N296S	probably benign	Het
Sema3c	G	A	5: 17,694,772	V421I	probably benign	Het
Slc15a4	A	G	5: 127,604,536		probably null	Het
Slc7a8	C	G	14: 54,735,790	G240A	possibly damaging	Het
Tmem200c	A	G	17: 68,842,171	D583G	probably benign	Het
Ttn	T	C	2: 76,822,588		probably null	Het
Vcp	T	C	4: 42,988,813		probably benign	Het
Vmn2r78	T	C	7: 86,954,603	V663A	probably damaging	Het
Vmn2r9	T	G	5: 108,847,685	M366L	probably benign	Het
Wdr11	A	G	7: 129,629,005	E878G	probably damaging	Het
Zan	C	G	5: 137,383,834	M5150I	unknown	Het

Other mutations in Trpm6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:Trpm6	APN	19	18783908	splice site	probably benign
IGL00862:Trpm6	APN	19	18827528	missense	probably damaging	1.00
IGL01348:Trpm6	APN	19	18877651	missense	probably damaging	1.00
IGL01400:Trpm6	APN	19	18825794	nonsense	probably null
IGL01451:Trpm6	APN	19	18809569	missense	probably damaging	1.00
IGL01508:Trpm6	APN	19	18796530	nonsense	probably null
IGL01995:Trpm6	APN	19	18830327	splice site	probably benign
IGL02092:Trpm6	APN	19	18772331	missense	possibly damaging	0.59
IGL02152:Trpm6	APN	19	18832539	missense	possibly damaging	0.93
IGL02294:Trpm6	APN	19	18854063	missense	probably benign
IGL02329:Trpm6	APN	19	18854217	missense	probably benign	0.17
IGL02366:Trpm6	APN	19	18778510	splice site	probably benign
IGL02402:Trpm6	APN	19	18786756	missense	probably benign	0.18
IGL02457:Trpm6	APN	19	18825791	missense	probably damaging	1.00
IGL02457:Trpm6	APN	19	18827398	nonsense	probably null
IGL02684:Trpm6	APN	19	18802207	splice site	probably benign
IGL02705:Trpm6	APN	19	18776733	critical splice donor site	probably null
IGL02728:Trpm6	APN	19	18809652	missense	possibly damaging	0.71
IGL02742:Trpm6	APN	19	18830012	splice site	probably benign
IGL02818:Trpm6	APN	19	18866257	missense	probably benign	0.04
IGL02836:Trpm6	APN	19	18813482	missense	probably damaging	1.00
IGL03119:Trpm6	APN	19	18838017	nonsense	probably null
IGL03193:Trpm6	APN	19	18825872	missense	possibly damaging	0.94
IGL03227:Trpm6	APN	19	18819119	missense	probably benign	0.01
IGL03227:Trpm6	APN	19	18786779	missense	probably benign	0.12
IGL03231:Trpm6	APN	19	18819181	missense	probably benign
IGL03245:Trpm6	APN	19	18877701	missense	probably damaging	1.00
IGL03328:Trpm6	APN	19	18838082	missense	possibly damaging	0.94
IGL03341:Trpm6	APN	19	18813486	missense	probably benign
P0043:Trpm6	UTSW	19	18877765	missense	probably damaging	1.00
PIT4260001:Trpm6	UTSW	19	18825802	missense	possibly damaging	0.48
R0057:Trpm6	UTSW	19	18786755	missense	probably benign	0.05
R0115:Trpm6	UTSW	19	18829952	missense	probably damaging	0.98
R0119:Trpm6	UTSW	19	18832593	missense	probably benign	0.05
R0140:Trpm6	UTSW	19	18819194	splice site	probably null
R0267:Trpm6	UTSW	19	18823378	missense	probably benign
R0350:Trpm6	UTSW	19	18883957	splice site	probably null
R0373:Trpm6	UTSW	19	18853587	missense	probably benign	0.15
R0393:Trpm6	UTSW	19	18778644	missense	probably damaging	0.99
R0416:Trpm6	UTSW	19	18783025	splice site	probably benign
R0505:Trpm6	UTSW	19	18873902	splice site	probably benign
R0526:Trpm6	UTSW	19	18792876	missense	probably damaging	0.97
R0607:Trpm6	UTSW	19	18872221	missense	probably benign	0.00
R0609:Trpm6	UTSW	19	18825862	missense	probably damaging	0.97
R0714:Trpm6	UTSW	19	18838087	missense	possibly damaging	0.90
R1215:Trpm6	UTSW	19	18796498	missense	probably damaging	1.00
R1474:Trpm6	UTSW	19	18796495	missense	probably benign	0.28
R1512:Trpm6	UTSW	19	18875931	missense	probably benign
R1558:Trpm6	UTSW	19	18786828	missense	probably benign	0.04
R1597:Trpm6	UTSW	19	18827524	missense	probably damaging	0.98
R1618:Trpm6	UTSW	19	18877631	missense	possibly damaging	0.88
R1779:Trpm6	UTSW	19	18856217	missense	probably damaging	1.00
R1796:Trpm6	UTSW	19	18827567	missense	possibly damaging	0.90
R1799:Trpm6	UTSW	19	18891999	splice site	probably null
R1840:Trpm6	UTSW	19	18866267	missense	probably benign	0.21
R1991:Trpm6	UTSW	19	18796284	missense	probably benign	0.00
R2030:Trpm6	UTSW	19	18854265	missense	probably benign
R2073:Trpm6	UTSW	19	18876042	missense	probably damaging	1.00
R2074:Trpm6	UTSW	19	18877739	missense	probably damaging	1.00
R2096:Trpm6	UTSW	19	18825752	missense	probably damaging	0.97
R2103:Trpm6	UTSW	19	18796284	missense	probably benign	0.00
R2106:Trpm6	UTSW	19	18813350	missense	possibly damaging	0.95
R2117:Trpm6	UTSW	19	18829952	missense	probably damaging	0.98
R2850:Trpm6	UTSW	19	18792090	missense	possibly damaging	0.68
R3125:Trpm6	UTSW	19	18854431	missense	probably benign	0.05
R3719:Trpm6	UTSW	19	18772393	nonsense	probably null
R3779:Trpm6	UTSW	19	18876039	missense	possibly damaging	0.80
R4115:Trpm6	UTSW	19	18832557	missense	probably damaging	1.00
R4367:Trpm6	UTSW	19	18827525	missense	probably damaging	0.99
R4523:Trpm6	UTSW	19	18796500	missense	probably damaging	1.00
R4564:Trpm6	UTSW	19	18832597	missense	possibly damaging	0.95
R4565:Trpm6	UTSW	19	18825872	missense	probably damaging	1.00
R4697:Trpm6	UTSW	19	18853791	missense	probably benign	0.01
R4714:Trpm6	UTSW	19	18854200	missense	possibly damaging	0.93
R4750:Trpm6	UTSW	19	18876064	missense	probably damaging	0.99
R4771:Trpm6	UTSW	19	18813493	missense	probably damaging	0.97
R4791:Trpm6	UTSW	19	18867981	missense	probably benign	0.00
R4814:Trpm6	UTSW	19	18862212	missense	probably benign	0.11
R5028:Trpm6	UTSW	19	18786760	missense	probably damaging	1.00
R5237:Trpm6	UTSW	19	18813464	missense	probably damaging	1.00
R5615:Trpm6	UTSW	19	18829933	missense	probably damaging	0.96
R5642:Trpm6	UTSW	19	18830207	missense	probably damaging	1.00
R5645:Trpm6	UTSW	19	18853604	missense	probably damaging	1.00
R5726:Trpm6	UTSW	19	18853617	missense	probably damaging	1.00
R5832:Trpm6	UTSW	19	18786819	missense	possibly damaging	0.66
R5843:Trpm6	UTSW	19	18856175	missense	probably benign	0.04
R5955:Trpm6	UTSW	19	18892019	missense	possibly damaging	0.75
R6101:Trpm6	UTSW	19	18853748	nonsense	probably null
R6105:Trpm6	UTSW	19	18853748	nonsense	probably null
R6211:Trpm6	UTSW	19	18783128	missense	probably damaging	1.00
R6228:Trpm6	UTSW	19	18854291	missense	probably damaging	1.00
R6263:Trpm6	UTSW	19	18854108	missense	possibly damaging	0.94
R6453:Trpm6	UTSW	19	18829990	missense	probably damaging	1.00
R6562:Trpm6	UTSW	19	18838042	missense	probably damaging	1.00
R6624:Trpm6	UTSW	19	18796439	critical splice acceptor site	probably null
R6624:Trpm6	UTSW	19	18889020	missense	probably damaging	1.00
R6729:Trpm6	UTSW	19	18830297	missense	probably damaging	1.00
R6765:Trpm6	UTSW	19	18877765	missense	probably damaging	1.00
R6976:Trpm6	UTSW	19	18783163	missense	probably benign
R7103:Trpm6	UTSW	19	18813547	missense	possibly damaging	0.87
R7126:Trpm6	UTSW	19	18854033	nonsense	probably null
R7128:Trpm6	UTSW	19	18811773	missense	possibly damaging	0.92
R7157:Trpm6	UTSW	19	18838098	missense	possibly damaging	0.91
R7212:Trpm6	UTSW	19	18853791	missense	probably benign	0.01
R7263:Trpm6	UTSW	19	18876786	missense	probably damaging	1.00
R7268:Trpm6	UTSW	19	18778585	missense	probably benign	0.13
R7305:Trpm6	UTSW	19	18876091	missense	probably benign	0.30
R7498:Trpm6	UTSW	19	18876120	missense	probably damaging	1.00
R7558:Trpm6	UTSW	19	18778665	missense	probably damaging	0.96
R7590:Trpm6	UTSW	19	18832581	missense	probably benign	0.31
R7646:Trpm6	UTSW	19	18867961	missense	probably benign	0.10
R7650:Trpm6	UTSW	19	18876013	missense	possibly damaging	0.70
R7727:Trpm6	UTSW	19	18854249	missense	probably damaging	0.97
R7743:Trpm6	UTSW	19	18827408	missense	probably benign	0.03
R7747:Trpm6	UTSW	19	18750045	splice site	probably null
R7807:Trpm6	UTSW	19	18829856	missense	probably benign	0.11
R7870:Trpm6	UTSW	19	18815241	missense	probably benign	0.01
R7891:Trpm6	UTSW	19	18776710	missense	probably benign	0.01
R7955:Trpm6	UTSW	19	18854290	missense	probably benign	0.01
R7965:Trpm6	UTSW	19	18876110	missense	probably damaging	1.00
R7967:Trpm6	UTSW	19	18778659	missense	probably damaging	0.99
R7992:Trpm6	UTSW	19	18815350	missense	probably damaging	1.00
R8035:Trpm6	UTSW	19	18792862	missense	probably damaging	0.97
R8108:Trpm6	UTSW	19	18811790	missense	probably damaging	1.00
R8268:Trpm6	UTSW	19	18873861	missense	possibly damaging	0.85
R8411:Trpm6	UTSW	19	18853968	missense	probably benign	0.39
R8413:Trpm6	UTSW	19	18832485	missense	probably benign	0.00
R8534:Trpm6	UTSW	19	18892095	missense	probably benign	0.00
R8932:Trpm6	UTSW	19	18838002	missense	possibly damaging	0.87
R8990:Trpm6	UTSW	19	18815435	missense	probably damaging	1.00
R9403:Trpm6	UTSW	19	18832652	missense	possibly damaging	0.84
R9446:Trpm6	UTSW	19	18838098	missense	possibly damaging	0.91
R9463:Trpm6	UTSW	19	18783900	critical splice donor site	probably null
R9485:Trpm6	UTSW	19	18778614	missense	probably benign	0.06
R9536:Trpm6	UTSW	19	18786759	missense	probably damaging	1.00
R9549:Trpm6	UTSW	19	18876030	nonsense	probably null
R9564:Trpm6	UTSW	19	18873876	missense	possibly damaging	0.92
R9626:Trpm6	UTSW	19	18813482	missense	probably damaging	1.00
R9655:Trpm6	UTSW	19	18892102	missense	probably benign
R9721:Trpm6	UTSW	19	18829972	missense	probably benign	0.12
R9742:Trpm6	UTSW	19	18823402	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- AGCACAACAGGGCAGTTTCTG -3'
(R):5'- GAAACTTACTTAGCCCTCCGTC -3'

Sequencing Primer
(F):5'- CCTAATATCTGATTTCAGTGTCTGC -3'
(R):5'- CGTCCCCCTCTTCCTGG -3'

Posted On

2015-08-18