Incidental Mutation 'R4547:Cfap65'
ID 333799
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Name cilia and flagella associated protein 65
Synonyms Ccdc108, B230363K08Rik
MMRRC Submission 041781-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.676) question?
Stock # R4547 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 74902071-74935599 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 74907612 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 1313 (T1313I)
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
AlphaFold Q3V0B4
Predicted Effect probably damaging
Transcript: ENSMUST00000094844
AA Change: T1313I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: T1313I

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160540
Meta Mutation Damage Score 0.2470 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 G T 14: 54,645,667 (GRCm38) A909E probably benign Het
Ankrd13a A G 5: 114,775,296 (GRCm38) E23G probably benign Het
Ano4 T C 10: 88,981,170 (GRCm38) R148G probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 (GRCm38) probably benign Het
Aspm T C 1: 139,478,187 (GRCm38) V1604A possibly damaging Het
Cdh1 C A 8: 106,663,903 (GRCm38) T625K probably damaging Het
Cfhr3 T G 1: 139,584,913 (GRCm38) noncoding transcript Het
Csmd1 T C 8: 16,391,797 (GRCm38) D351G possibly damaging Het
Dis3l2 A T 1: 87,049,671 (GRCm38) T861S probably benign Het
Dnah6 A T 6: 73,192,405 (GRCm38) D404E probably benign Het
Dpm1 A G 2: 168,223,153 (GRCm38) L88P probably damaging Het
Fabp3 C T 4: 130,312,452 (GRCm38) probably null Het
Fat4 T C 3: 38,951,283 (GRCm38) F1944L probably damaging Het
Frmd4a C A 2: 4,473,145 (GRCm38) L46I probably damaging Het
Gpr39 G A 1: 125,677,991 (GRCm38) V219I probably benign Het
Hace1 T A 10: 45,672,555 (GRCm38) probably null Het
Kdm1b C T 13: 47,063,077 (GRCm38) R308W probably damaging Het
Klb T A 5: 65,379,928 (GRCm38) V867E probably benign Het
Lnpk C G 2: 74,522,286 (GRCm38) E351Q probably benign Het
Mettl25 T C 10: 105,826,017 (GRCm38) D364G probably damaging Het
Mrc2 G A 11: 105,336,641 (GRCm38) V567I probably benign Het
Mrm2 T C 5: 140,328,496 (GRCm38) T195A probably benign Het
Naaa C T 5: 92,263,586 (GRCm38) probably null Het
Ncdn A G 4: 126,746,674 (GRCm38) F542S probably damaging Het
Nlrp4e A G 7: 23,336,866 (GRCm38) N715D probably benign Het
Nup42 T C 5: 24,177,970 (GRCm38) probably benign Het
Or10ag57 G A 2: 87,388,160 (GRCm38) V152I probably benign Het
Or2t6 A T 14: 14,175,854 (GRCm38) I76N probably damaging Het
Psg25 A G 7: 18,524,704 (GRCm38) L349P probably damaging Het
Rnf213 G T 11: 119,479,670 (GRCm38) probably null Het
Scara5 A C 14: 65,670,574 (GRCm38) K4N possibly damaging Het
Slc35f5 T C 1: 125,572,382 (GRCm38) L211S probably benign Het
Slc44a4 T A 17: 34,927,755 (GRCm38) F285I probably damaging Het
Slc8a3 A G 12: 81,314,851 (GRCm38) V398A possibly damaging Het
Smc2 T C 4: 52,467,866 (GRCm38) S737P probably benign Het
Speer2 T C 16: 69,858,849 (GRCm38) K30E probably damaging Het
Synj1 T C 16: 90,988,282 (GRCm38) I229V possibly damaging Het
Tac1 A G 6: 7,557,216 (GRCm38) D74G probably damaging Het
Tbc1d17 A G 7: 44,841,347 (GRCm38) V607A probably benign Het
Tmem132a A G 19: 10,860,200 (GRCm38) V582A possibly damaging Het
Traf4 A G 11: 78,161,037 (GRCm38) I207T possibly damaging Het
Trio T C 15: 27,818,982 (GRCm38) R449G possibly damaging Het
Ubn1 G A 16: 5,072,092 (GRCm38) R407H probably damaging Het
Vmn1r19 C T 6: 57,404,789 (GRCm38) T109I possibly damaging Het
Vmn2r60 A G 7: 42,135,663 (GRCm38) T100A probably null Het
Vsig8 A T 1: 172,560,596 (GRCm38) M44L probably benign Het
Zbed5 T A 5: 129,902,851 (GRCm38) L547* probably null Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74,919,183 (GRCm38) critical splice donor site probably null
IGL01526:Cfap65 APN 1 74,911,078 (GRCm38) missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74,927,194 (GRCm38) missense probably benign
IGL01780:Cfap65 APN 1 74,928,348 (GRCm38) nonsense probably null
IGL01993:Cfap65 APN 1 74,920,543 (GRCm38) missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74,928,145 (GRCm38) missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74,928,348 (GRCm38) nonsense probably null
IGL02357:Cfap65 APN 1 74,928,348 (GRCm38) nonsense probably null
IGL02576:Cfap65 APN 1 74,903,458 (GRCm38) missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74,905,080 (GRCm38) missense probably benign 0.00
IGL02792:Cfap65 APN 1 74,927,178 (GRCm38) missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74,911,108 (GRCm38) nonsense probably null
IGL03101:Cfap65 APN 1 74,928,433 (GRCm38) missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74,927,619 (GRCm38) missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74,904,642 (GRCm38) missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74,928,342 (GRCm38) missense probably benign 0.05
R0077:Cfap65 UTSW 1 74,931,918 (GRCm38) missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74,931,958 (GRCm38) nonsense probably null
R0281:Cfap65 UTSW 1 74,927,071 (GRCm38) missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74,904,067 (GRCm38) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,929,302 (GRCm38) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,929,301 (GRCm38) missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74,926,444 (GRCm38) missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74,920,601 (GRCm38) missense probably benign 0.00
R0361:Cfap65 UTSW 1 74,925,440 (GRCm38) missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74,916,884 (GRCm38) missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74,918,444 (GRCm38) missense probably benign 0.01
R0646:Cfap65 UTSW 1 74,902,169 (GRCm38) missense probably benign 0.09
R0734:Cfap65 UTSW 1 74,918,887 (GRCm38) missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74,904,682 (GRCm38) missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74,921,519 (GRCm38) missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74,905,713 (GRCm38) missense probably damaging 0.99
R1079:Cfap65 UTSW 1 74,902,447 (GRCm38) missense probably damaging 0.98
R1083:Cfap65 UTSW 1 74,918,504 (GRCm38) splice site probably benign
R1159:Cfap65 UTSW 1 74,929,340 (GRCm38) missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74,925,104 (GRCm38) missense probably benign 0.03
R1644:Cfap65 UTSW 1 74,917,175 (GRCm38) missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74,918,948 (GRCm38) missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74,907,660 (GRCm38) missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74,917,199 (GRCm38) missense probably benign 0.30
R2132:Cfap65 UTSW 1 74,907,691 (GRCm38) missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74,917,273 (GRCm38) frame shift probably null
R2219:Cfap65 UTSW 1 74,904,025 (GRCm38) missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74,904,025 (GRCm38) missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74,926,475 (GRCm38) missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74,927,186 (GRCm38) small insertion probably benign
R3114:Cfap65 UTSW 1 74,927,132 (GRCm38) missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74,920,542 (GRCm38) missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74,927,681 (GRCm38) missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74,903,358 (GRCm38) missense probably benign 0.17
R4548:Cfap65 UTSW 1 74,907,612 (GRCm38) missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74,904,056 (GRCm38) missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74,925,354 (GRCm38) intron probably benign
R4701:Cfap65 UTSW 1 74,918,908 (GRCm38) missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74,928,361 (GRCm38) missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74,927,632 (GRCm38) missense probably benign 0.06
R4831:Cfap65 UTSW 1 74,917,295 (GRCm38) missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74,925,557 (GRCm38) missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74,919,261 (GRCm38) missense probably benign 0.00
R4881:Cfap65 UTSW 1 74,907,613 (GRCm38) missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74,903,124 (GRCm38) missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74,906,336 (GRCm38) nonsense probably null
R5074:Cfap65 UTSW 1 74,922,978 (GRCm38) missense probably benign 0.04
R5083:Cfap65 UTSW 1 74,906,441 (GRCm38) missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74,926,516 (GRCm38) missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74,924,902 (GRCm38) missense probably benign 0.07
R5333:Cfap65 UTSW 1 74,903,175 (GRCm38) missense probably benign 0.03
R5417:Cfap65 UTSW 1 74,925,100 (GRCm38) missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74,907,518 (GRCm38) intron probably benign
R5669:Cfap65 UTSW 1 74,924,968 (GRCm38) missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74,923,031 (GRCm38) missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74,920,405 (GRCm38) missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74,903,139 (GRCm38) missense probably benign 0.14
R6425:Cfap65 UTSW 1 74,927,709 (GRCm38) missense probably benign 0.00
R6677:Cfap65 UTSW 1 74,904,685 (GRCm38) missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74,917,286 (GRCm38) missense probably benign 0.00
R6838:Cfap65 UTSW 1 74,932,021 (GRCm38) missense probably benign 0.06
R6861:Cfap65 UTSW 1 74,925,115 (GRCm38) missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74,931,899 (GRCm38) missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74,926,633 (GRCm38) missense probably benign 0.01
R7320:Cfap65 UTSW 1 74,926,604 (GRCm38) missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74,921,583 (GRCm38) missense probably benign 0.07
R7426:Cfap65 UTSW 1 74,920,426 (GRCm38) missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74,926,610 (GRCm38) missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74,902,434 (GRCm38) missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74,933,144 (GRCm38) missense probably benign 0.44
R7704:Cfap65 UTSW 1 74,928,368 (GRCm38) missense probably benign 0.19
R7727:Cfap65 UTSW 1 74,926,625 (GRCm38) missense probably benign 0.00
R7895:Cfap65 UTSW 1 74,933,162 (GRCm38) missense probably benign 0.05
R8215:Cfap65 UTSW 1 74,910,743 (GRCm38) missense probably damaging 1.00
R8344:Cfap65 UTSW 1 74,928,044 (GRCm38) missense probably benign 0.01
R8345:Cfap65 UTSW 1 74,928,044 (GRCm38) missense probably benign 0.01
R8413:Cfap65 UTSW 1 74,917,169 (GRCm38) nonsense probably null
R8431:Cfap65 UTSW 1 74,928,044 (GRCm38) missense probably benign 0.01
R8432:Cfap65 UTSW 1 74,928,044 (GRCm38) missense probably benign 0.01
R8528:Cfap65 UTSW 1 74,905,937 (GRCm38) missense possibly damaging 0.88
R8809:Cfap65 UTSW 1 74,903,223 (GRCm38) missense probably benign 0.43
R8996:Cfap65 UTSW 1 74,902,188 (GRCm38) missense probably benign 0.11
R9020:Cfap65 UTSW 1 74,920,393 (GRCm38) missense probably damaging 1.00
R9043:Cfap65 UTSW 1 74,904,688 (GRCm38) missense possibly damaging 0.88
R9127:Cfap65 UTSW 1 74,919,351 (GRCm38) splice site probably benign
R9187:Cfap65 UTSW 1 74,917,358 (GRCm38) missense probably benign 0.00
R9210:Cfap65 UTSW 1 74,920,408 (GRCm38) missense probably benign
R9212:Cfap65 UTSW 1 74,920,408 (GRCm38) missense probably benign
R9273:Cfap65 UTSW 1 74,921,610 (GRCm38) missense probably benign 0.00
R9454:Cfap65 UTSW 1 74,905,051 (GRCm38) missense probably damaging 1.00
R9514:Cfap65 UTSW 1 74,906,309 (GRCm38) critical splice donor site probably null
R9595:Cfap65 UTSW 1 74,907,378 (GRCm38) missense probably damaging 1.00
R9721:Cfap65 UTSW 1 74,919,342 (GRCm38) missense probably benign 0.16
R9742:Cfap65 UTSW 1 74,904,681 (GRCm38) missense probably benign 0.08
RF009:Cfap65 UTSW 1 74,905,647 (GRCm38) missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74,910,747 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACACAGGGGTCATATCCTAC -3'
(R):5'- TACCCTTGCAGATTTACGAGC -3'

Sequencing Primer
(F):5'- GGTCATATCCTACTCCTTGGAAGCAG -3'
(R):5'- CAGATTTACGAGCTGTACAATGGC -3'
Posted On 2015-08-18