Incidental Mutation 'R4547:Slc35f5'
ID333801
Institutional Source Beutler Lab
Gene Symbol Slc35f5
Ensembl Gene ENSMUSG00000026342
Gene Namesolute carrier family 35, member F5
Synonyms1300003P13Rik
MMRRC Submission 041781-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.574) question?
Stock #R4547 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location125560595-125595820 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125572382 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 211 (L211S)
Ref Sequence ENSEMBL: ENSMUSP00000027580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027580] [ENSMUST00000190037]
Predicted Effect probably benign
Transcript: ENSMUST00000027580
AA Change: L211S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000027580
Gene: ENSMUSG00000026342
AA Change: L211S

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
transmembrane domain 69 86 N/A INTRINSIC
transmembrane domain 101 120 N/A INTRINSIC
Pfam:EamA 226 317 2.1e-8 PFAM
transmembrane domain 329 348 N/A INTRINSIC
transmembrane domain 360 382 N/A INTRINSIC
transmembrane domain 397 419 N/A INTRINSIC
transmembrane domain 421 443 N/A INTRINSIC
transmembrane domain 453 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190037
SMART Domains Protein: ENSMUSP00000139639
Gene: ENSMUSG00000026342

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
transmembrane domain 91 108 N/A INTRINSIC
transmembrane domain 123 142 N/A INTRINSIC
Meta Mutation Damage Score 0.1037 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 96% (55/57)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 G T 14: 54,645,667 A909E probably benign Het
Ankrd13a A G 5: 114,775,296 E23G probably benign Het
Ano4 T C 10: 88,981,170 R148G probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Aspm T C 1: 139,478,187 V1604A possibly damaging Het
Cdh1 C A 8: 106,663,903 T625K probably damaging Het
Cfap65 G A 1: 74,907,612 T1313I probably damaging Het
Cfhr3 T G 1: 139,584,913 noncoding transcript Het
Csmd1 T C 8: 16,391,797 D351G possibly damaging Het
Dis3l2 A T 1: 87,049,671 T861S probably benign Het
Dnah6 A T 6: 73,192,405 D404E probably benign Het
Dpm1 A G 2: 168,223,153 L88P probably damaging Het
Fabp3 C T 4: 130,312,452 probably null Het
Fat4 T C 3: 38,951,283 F1944L probably damaging Het
Frmd4a C A 2: 4,473,145 L46I probably damaging Het
Gpr39 G A 1: 125,677,991 V219I probably benign Het
Hace1 T A 10: 45,672,555 probably null Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Klb T A 5: 65,379,928 V867E probably benign Het
Lnpk C G 2: 74,522,286 E351Q probably benign Het
Mettl25 T C 10: 105,826,017 D364G probably damaging Het
Mrc2 G A 11: 105,336,641 V567I probably benign Het
Mrm2 T C 5: 140,328,496 T195A probably benign Het
Naaa C T 5: 92,263,586 probably null Het
Ncdn A G 4: 126,746,674 F542S probably damaging Het
Nlrp4e A G 7: 23,336,866 N715D probably benign Het
Nupl2 T C 5: 24,177,970 probably benign Het
Olfr1122 G A 2: 87,388,160 V152I probably benign Het
Olfr720 A T 14: 14,175,854 I76N probably damaging Het
Psg25 A G 7: 18,524,704 L349P probably damaging Het
Rnf213 G T 11: 119,479,670 probably null Het
Scara5 A C 14: 65,670,574 K4N possibly damaging Het
Slc44a4 T A 17: 34,927,755 F285I probably damaging Het
Slc8a3 A G 12: 81,314,851 V398A possibly damaging Het
Smc2 T C 4: 52,467,866 S737P probably benign Het
Speer2 T C 16: 69,858,849 K30E probably damaging Het
Synj1 T C 16: 90,988,282 I229V possibly damaging Het
Tac1 A G 6: 7,557,216 D74G probably damaging Het
Tbc1d17 A G 7: 44,841,347 V607A probably benign Het
Tmem132a A G 19: 10,860,200 V582A possibly damaging Het
Traf4 A G 11: 78,161,037 I207T possibly damaging Het
Trio T C 15: 27,818,982 R449G possibly damaging Het
Ubn1 G A 16: 5,072,092 R407H probably damaging Het
Vmn1r19 C T 6: 57,404,789 T109I possibly damaging Het
Vmn2r60 A G 7: 42,135,663 T100A probably null Het
Vsig8 A T 1: 172,560,596 M44L probably benign Het
Zbed5 T A 5: 129,902,851 L547* probably null Het
Other mutations in Slc35f5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Slc35f5 APN 1 125587424 missense probably damaging 1.00
IGL01844:Slc35f5 APN 1 125589875 missense probably damaging 0.96
IGL02218:Slc35f5 APN 1 125584555 missense probably damaging 1.00
IGL02586:Slc35f5 APN 1 125584536 missense probably damaging 1.00
IGL03000:Slc35f5 APN 1 125574742 missense probably damaging 1.00
IGL03160:Slc35f5 APN 1 125574735 missense probably damaging 1.00
IGL03181:Slc35f5 APN 1 125585185 missense probably damaging 1.00
IGL02984:Slc35f5 UTSW 1 125562513 missense probably benign 0.28
R0127:Slc35f5 UTSW 1 125576205 missense probably damaging 1.00
R0390:Slc35f5 UTSW 1 125585095 missense probably damaging 1.00
R0513:Slc35f5 UTSW 1 125576169 splice site probably benign
R1701:Slc35f5 UTSW 1 125570593 missense possibly damaging 0.77
R1716:Slc35f5 UTSW 1 125584532 missense possibly damaging 0.65
R2211:Slc35f5 UTSW 1 125579264 missense possibly damaging 0.74
R3024:Slc35f5 UTSW 1 125568598 missense probably benign 0.00
R3870:Slc35f5 UTSW 1 125562361 missense probably benign 0.00
R4239:Slc35f5 UTSW 1 125572474 missense possibly damaging 0.94
R5622:Slc35f5 UTSW 1 125589956 missense probably damaging 1.00
R5688:Slc35f5 UTSW 1 125591038 missense probably benign 0.23
R5876:Slc35f5 UTSW 1 125587363 critical splice acceptor site probably null
R6701:Slc35f5 UTSW 1 125562610 missense probably damaging 1.00
R7292:Slc35f5 UTSW 1 125572485 missense probably damaging 0.99
R7368:Slc35f5 UTSW 1 125584519 missense probably damaging 1.00
R7530:Slc35f5 UTSW 1 125584538 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTTACCTTTGATCATAAGTGAACAG -3'
(R):5'- TGGTATGTGCACCATCTTAAATAAGG -3'

Sequencing Primer
(F):5'- GGATCTGAGGGTTCATTTAAT -3'
(R):5'- GGTTGCAGTCAATTTCCCT -3'
Posted On2015-08-18